Incidental Mutation 'R5075:Mier1'
ID 386916
Institutional Source Beutler Lab
Gene Symbol Mier1
Ensembl Gene ENSMUSG00000028522
Gene Name MEIR1 treanscription regulator
Synonyms 4933425I22Rik, 5830411K19Rik
MMRRC Submission 042664-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5075 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 102971587-103022951 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102996670 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 99 (D99G)
Ref Sequence ENSEMBL: ENSMUSP00000102470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030247] [ENSMUST00000097945] [ENSMUST00000106855] [ENSMUST00000106857] [ENSMUST00000106858]
AlphaFold Q5UAK0
Predicted Effect probably benign
Transcript: ENSMUST00000030247
AA Change: D116G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030247
Gene: ENSMUSG00000028522
AA Change: D116G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097945
AA Change: D144G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095558
Gene: ENSMUSG00000028522
AA Change: D144G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
low complexity region 128 149 N/A INTRINSIC
low complexity region 204 221 N/A INTRINSIC
ELM2 226 279 1.14e-11 SMART
SANT 328 377 7.01e-9 SMART
low complexity region 410 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106855
SMART Domains Protein: ENSMUSP00000102468
Gene: ENSMUSG00000028522

DomainStartEndE-ValueType
ELM2 1 53 2.51e-8 SMART
SANT 102 151 7.01e-9 SMART
low complexity region 184 211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106857
AA Change: D99G

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000102470
Gene: ENSMUSG00000028522
AA Change: D99G

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 40 48 N/A INTRINSIC
low complexity region 83 104 N/A INTRINSIC
low complexity region 159 176 N/A INTRINSIC
ELM2 181 234 1.14e-11 SMART
SANT 283 332 7.01e-9 SMART
low complexity region 365 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106858
AA Change: D116G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000102471
Gene: ENSMUSG00000028522
AA Change: D116G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 57 65 N/A INTRINSIC
low complexity region 100 121 N/A INTRINSIC
low complexity region 176 193 N/A INTRINSIC
ELM2 198 251 1.14e-11 SMART
SANT 300 349 7.01e-9 SMART
low complexity region 382 409 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151588
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149259
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was first identified in Xenopus laevis by its role in a mesoderm induction early response (MIER). The encoded protein functions as a transcriptional regulator. Alternatively spliced transcript variants encode multiple isoforms, some of which lack a C-terminal nuclear localization signal. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl A G 3: 116,587,456 (GRCm39) F33S probably damaging Het
Atf7ip A G 6: 136,537,232 (GRCm39) D163G probably benign Het
Cep85 C A 4: 133,859,678 (GRCm39) D662Y probably damaging Het
Cntn6 T A 6: 104,809,991 (GRCm39) S558T probably damaging Het
Dnah8 T C 17: 30,958,731 (GRCm39) probably null Het
Dnah8 T A 17: 31,019,505 (GRCm39) N3859K probably damaging Het
Dnah8 G A 17: 30,967,542 (GRCm39) D2585N probably benign Het
Dnajc21 G T 15: 10,461,963 (GRCm39) T146K probably benign Het
Ep400 T C 5: 110,833,351 (GRCm39) E1957G unknown Het
Esm1 A G 13: 113,349,892 (GRCm39) Y104C probably damaging Het
Fkbp15 T C 4: 62,239,266 (GRCm39) K613R probably damaging Het
Gm10722 A C 9: 3,001,041 (GRCm39) Y39S probably benign Het
Gm5592 A G 7: 40,808,387 (GRCm39) probably benign Het
Hdac4 A G 1: 91,923,842 (GRCm39) S223P probably benign Het
Hypk A G 2: 121,286,111 (GRCm39) probably benign Het
Kpna1 T A 16: 35,829,722 (GRCm39) F70I probably damaging Het
Lrp2 A G 2: 69,296,102 (GRCm39) Y3336H probably benign Het
Muc4 T C 16: 32,754,794 (GRCm38) probably benign Het
Nup160 A G 2: 90,530,518 (GRCm39) E463G probably damaging Het
Or5b121 T A 19: 13,507,637 (GRCm39) M244K probably benign Het
Peg3 A T 7: 6,711,419 (GRCm39) C1268S probably damaging Het
Recql4 G A 15: 76,593,744 (GRCm39) P122L probably damaging Het
Rex2 A T 4: 147,142,151 (GRCm39) Q213L possibly damaging Het
Rnf25 A G 1: 74,634,803 (GRCm39) V73A probably benign Het
Sacm1l A G 9: 123,411,327 (GRCm39) D372G probably benign Het
Selplg T C 5: 113,958,045 (GRCm39) D87G probably benign Het
Sgsh G A 11: 119,237,594 (GRCm39) T340M probably benign Het
Slc4a3 A T 1: 75,534,012 (GRCm39) I1120F probably damaging Het
Snrnp40 T C 4: 130,282,375 (GRCm39) Y311H probably benign Het
Spata31e2 T C 1: 26,722,133 (GRCm39) K1016E probably damaging Het
Stard7 A T 2: 127,111,879 (GRCm39) probably benign Het
Stat1 A T 1: 52,161,871 (GRCm39) K40M possibly damaging Het
Sun1 T C 5: 139,212,646 (GRCm39) probably null Het
Tet2 T A 3: 133,192,667 (GRCm39) Q589L probably benign Het
Tmc7 A T 7: 118,151,919 (GRCm39) probably null Het
Tmt1b A G 10: 128,796,549 (GRCm39) F87L probably damaging Het
Unc79 A T 12: 103,041,213 (GRCm39) I749F possibly damaging Het
Ust A G 10: 8,393,988 (GRCm39) F59S probably damaging Het
Wdr81 A T 11: 75,343,307 (GRCm39) D653E probably benign Het
Zfat A G 15: 68,052,079 (GRCm39) S572P probably benign Het
Zmynd15 G C 11: 70,352,946 (GRCm39) E143D probably damaging Het
Zzef1 A G 11: 72,749,170 (GRCm39) E886G probably damaging Het
Other mutations in Mier1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01586:Mier1 APN 4 103,012,769 (GRCm39) missense probably damaging 0.99
IGL01599:Mier1 APN 4 103,012,738 (GRCm39) missense possibly damaging 0.58
IGL01996:Mier1 APN 4 102,984,473 (GRCm39) missense possibly damaging 0.93
IGL02228:Mier1 APN 4 102,988,259 (GRCm39) missense possibly damaging 0.85
R0194:Mier1 UTSW 4 102,996,716 (GRCm39) splice site probably null
R0505:Mier1 UTSW 4 103,012,820 (GRCm39) splice site probably benign
R0684:Mier1 UTSW 4 102,996,631 (GRCm39) missense probably damaging 0.99
R0691:Mier1 UTSW 4 102,996,699 (GRCm39) missense probably benign 0.07
R2997:Mier1 UTSW 4 102,988,233 (GRCm39) missense probably damaging 1.00
R4273:Mier1 UTSW 4 103,019,628 (GRCm39) missense possibly damaging 0.93
R4728:Mier1 UTSW 4 102,997,402 (GRCm39) missense probably damaging 1.00
R4769:Mier1 UTSW 4 102,997,417 (GRCm39) missense probably benign 0.01
R4798:Mier1 UTSW 4 102,988,195 (GRCm39) missense probably damaging 1.00
R5260:Mier1 UTSW 4 103,019,907 (GRCm39) missense probably benign 0.04
R5663:Mier1 UTSW 4 103,007,739 (GRCm39) missense probably damaging 0.96
R5924:Mier1 UTSW 4 103,016,899 (GRCm39) nonsense probably null
R7253:Mier1 UTSW 4 102,996,544 (GRCm39) splice site probably null
R7304:Mier1 UTSW 4 102,996,599 (GRCm39) nonsense probably null
R7641:Mier1 UTSW 4 102,996,637 (GRCm39) missense possibly damaging 0.89
R7998:Mier1 UTSW 4 103,019,812 (GRCm39) missense probably benign 0.09
R8000:Mier1 UTSW 4 102,988,240 (GRCm39) missense probably damaging 1.00
R8557:Mier1 UTSW 4 102,996,543 (GRCm39) splice site probably null
R9353:Mier1 UTSW 4 103,012,800 (GRCm39) missense probably damaging 0.97
R9537:Mier1 UTSW 4 103,019,758 (GRCm39) missense probably benign 0.00
R9759:Mier1 UTSW 4 103,019,725 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ATAGCATGGAAGCCCTAAAATCACTG -3'
(R):5'- TCTCATGGAAGTGAATCCTAAGG -3'

Sequencing Primer
(F):5'- TGGAAGCCCTAAAATCACTGATGTC -3'
(R):5'- TGGAAGTGAATCCTAAGGAATTTTC -3'
Posted On 2016-06-06