Incidental Mutation 'R0426:Vars2'
ID38692
Institutional Source Beutler Lab
Gene Symbol Vars2
Ensembl Gene ENSMUSG00000038838
Gene Namevalyl-tRNA synthetase 2, mitochondrial
SynonymsVars2l
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0426 (G1)
Quality Score183
Status Validated
Chromosome17
Chromosomal Location35655634-35667592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35664584 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 262 (V262E)
Ref Sequence ENSEMBL: ENSMUSP00000047917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001565] [ENSMUST00000043674] [ENSMUST00000160734] [ENSMUST00000160752] [ENSMUST00000165144] [ENSMUST00000169093]
Predicted Effect probably benign
Transcript: ENSMUST00000001565
SMART Domains Protein: ENSMUSP00000001565
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 6.4e-141 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000043674
AA Change: V262E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047917
Gene: ENSMUSG00000038838
AA Change: V262E

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 112 736 3.3e-179 PFAM
Pfam:tRNA-synt_1g 141 221 2e-8 PFAM
Pfam:Anticodon_1 780 932 3.6e-32 PFAM
low complexity region 1005 1015 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160535
Predicted Effect probably benign
Transcript: ENSMUST00000160734
SMART Domains Protein: ENSMUSP00000124335
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 375 1.9e-137 PFAM
PDB:3DOM|C 383 459 7e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160752
SMART Domains Protein: ENSMUSP00000124458
Gene: ENSMUSG00000001524

DomainStartEndE-ValueType
Pfam:Tfb2 22 160 6.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162927
Predicted Effect probably benign
Transcript: ENSMUST00000164404
SMART Domains Protein: ENSMUSP00000126084
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 201 1e-49 PFAM
Pfam:tRNA-synt_1g 68 172 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164978
Predicted Effect probably benign
Transcript: ENSMUST00000165144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168885
Predicted Effect probably benign
Transcript: ENSMUST00000168922
SMART Domains Protein: ENSMUSP00000129196
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 2 386 3e-105 PFAM
Pfam:Anticodon_1 430 566 8.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169093
SMART Domains Protein: ENSMUSP00000126794
Gene: ENSMUSG00000038838

DomainStartEndE-ValueType
Pfam:tRNA-synt_1 1 109 1.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174129
Meta Mutation Damage Score 0.6516 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial aminoacyl-tRNA synthetase, which catalyzes the attachment of valine to tRNA(Val) for mitochondrial translation. Mutations in this gene cause combined oxidative phosphorylation deficiency-20, and are also associated with early-onset mitochondrial encephalopathies. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dnmbp A G 19: 43,852,436 probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Vars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Vars2 APN 17 35664621 unclassified probably benign
IGL02320:Vars2 APN 17 35660454 missense probably benign 0.07
IGL02580:Vars2 APN 17 35660885 missense possibly damaging 0.50
IGL02691:Vars2 APN 17 35660248 missense probably damaging 1.00
IGL03039:Vars2 APN 17 35664121 missense probably damaging 1.00
PIT4445001:Vars2 UTSW 17 35666211 nonsense probably null
R0079:Vars2 UTSW 17 35659156 missense probably damaging 0.99
R0152:Vars2 UTSW 17 35660027 missense probably damaging 1.00
R0346:Vars2 UTSW 17 35664864 unclassified probably benign
R0584:Vars2 UTSW 17 35666686 missense possibly damaging 0.82
R0589:Vars2 UTSW 17 35659176 missense probably benign
R0882:Vars2 UTSW 17 35657299 missense probably benign 0.41
R1234:Vars2 UTSW 17 35667146 missense probably damaging 1.00
R1263:Vars2 UTSW 17 35661609 missense probably damaging 1.00
R1559:Vars2 UTSW 17 35666258 unclassified probably benign
R1772:Vars2 UTSW 17 35660084 missense probably damaging 1.00
R1809:Vars2 UTSW 17 35662216 missense probably damaging 1.00
R1913:Vars2 UTSW 17 35666922 missense probably benign 0.02
R1986:Vars2 UTSW 17 35660061 missense probably damaging 1.00
R2504:Vars2 UTSW 17 35664793 missense probably damaging 1.00
R3426:Vars2 UTSW 17 35661974 missense probably damaging 1.00
R4539:Vars2 UTSW 17 35666888 missense probably damaging 0.99
R4751:Vars2 UTSW 17 35659343 missense possibly damaging 0.89
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R4861:Vars2 UTSW 17 35661933 missense probably benign 0.00
R5028:Vars2 UTSW 17 35659473 critical splice donor site probably null
R5217:Vars2 UTSW 17 35658149 missense probably damaging 1.00
R5292:Vars2 UTSW 17 35660786 missense probably damaging 1.00
R6056:Vars2 UTSW 17 35665788 missense probably benign 0.01
R6211:Vars2 UTSW 17 35665662 unclassified probably null
R6213:Vars2 UTSW 17 35660440 missense probably benign 0.27
R6374:Vars2 UTSW 17 35660045 missense probably damaging 1.00
R6746:Vars2 UTSW 17 35660402 critical splice donor site probably null
R6749:Vars2 UTSW 17 35666713 missense probably damaging 1.00
R6957:Vars2 UTSW 17 35667075 missense probably benign 0.39
R7107:Vars2 UTSW 17 35658250 missense probably damaging 1.00
R7428:Vars2 UTSW 17 35666686 missense probably benign 0.00
R7538:Vars2 UTSW 17 35660780 missense probably damaging 1.00
R7553:Vars2 UTSW 17 35664788 missense possibly damaging 0.93
R7741:Vars2 UTSW 17 35660943 missense probably damaging 1.00
R7784:Vars2 UTSW 17 35658158 missense possibly damaging 0.95
R7823:Vars2 UTSW 17 35659136 missense probably damaging 1.00
X0021:Vars2 UTSW 17 35659034 missense possibly damaging 0.93
Z1176:Vars2 UTSW 17 35664791 missense possibly damaging 0.55
Z1177:Vars2 UTSW 17 35663472 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAATACAGACACCTGTGGCGGC -3'
(R):5'- TTCTATCTCCATCAGCGGGGTCAG -3'

Sequencing Primer
(F):5'- GCCGCAAGGACCTCACTC -3'
(R):5'- ACTGATAGAAATCTCTGGTGCAG -3'
Posted On2013-05-23