Incidental Mutation 'R5078:Olfr1165-ps'
ID 386949
Institutional Source Beutler Lab
Gene Symbol Olfr1165-ps
Ensembl Gene ENSMUSG00000046590
Gene Name olfactory receptor 1165, pseudogene
Synonyms GA_x6K02T2Q125-49593880-49592930, MOR174-7
MMRRC Submission 042667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R5078 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 88101036-88101985 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88101535 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 151 (I151L)
Ref Sequence ENSEMBL: ENSMUSP00000149054 (fasta)
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000117860
AA Change: I151L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,323,907 S345G probably benign Het
Adgrf2 A T 17: 42,710,986 F316I probably damaging Het
Ank2 A G 3: 126,942,353 probably benign Het
Auts2 T C 5: 132,258,947 K66E possibly damaging Het
Bicra T C 7: 15,975,457 D1144G probably damaging Het
Cabin1 A G 10: 75,721,478 S1109P probably damaging Het
Camkv T C 9: 107,945,373 V29A probably damaging Het
Ccdc178 A T 18: 22,067,628 probably null Het
Ccser1 G A 6: 61,311,366 R171H probably damaging Het
Cdk19 A G 10: 40,436,154 Y133C probably damaging Het
Cerkl T A 2: 79,393,008 D123V probably benign Het
Chd1 T C 17: 15,726,354 S121P possibly damaging Het
Col4a2 T C 8: 11,443,936 V1459A probably benign Het
Dlg1 T A 16: 31,856,469 Y704* probably null Het
Dsg2 T C 18: 20,596,083 probably null Het
Egln3 T C 12: 54,181,667 R218G probably damaging Het
Gm11568 T C 11: 99,858,355 C129R unknown Het
Gm13991 T C 2: 116,527,874 noncoding transcript Het
Gmnc C A 16: 26,965,582 V58L probably benign Het
Gpx5 A G 13: 21,288,711 F151S probably damaging Het
Helz G A 11: 107,656,096 G1079R probably damaging Het
Ice1 T C 13: 70,604,850 E1039G probably benign Het
Kif18a T C 2: 109,295,142 probably benign Het
Klhl29 T C 12: 5,093,530 T500A possibly damaging Het
Lrfn5 A C 12: 61,843,874 K650Q possibly damaging Het
Lrp2 T C 2: 69,501,530 D1627G possibly damaging Het
Nxn T C 11: 76,261,607 K354E probably damaging Het
Pcnx2 T C 8: 125,752,156 T2118A probably benign Het
Phldb2 A G 16: 45,777,742 F861L possibly damaging Het
Piezo2 A G 18: 63,024,536 Y2368H probably damaging Het
Pnp T A 14: 50,951,506 L252* probably null Het
Prom2 T C 2: 127,531,837 Q641R probably benign Het
Prpf31 T C 7: 3,634,703 S180P possibly damaging Het
Prss27 C A 17: 24,044,440 Y142* probably null Het
Ripk1 T G 13: 34,017,099 M265R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ropn1 T A 16: 34,666,791 D32E probably damaging Het
Rps23 T C 13: 90,923,703 F41L probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Selenot C T 3: 58,585,271 R60W probably damaging Het
Tll1 T C 8: 64,093,887 K342E probably damaging Het
Tlx1 A T 19: 45,156,021 N61Y probably damaging Het
Vmn2r117 T A 17: 23,460,148 I701F probably damaging Het
Zmynd12 A G 4: 119,444,850 K229E probably damaging Het
Other mutations in Olfr1165-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4378:Olfr1165-ps UTSW 2 88101485 missense unknown
R6373:Olfr1165-ps UTSW 2 88101845 missense possibly damaging 0.73
R6698:Olfr1165-ps UTSW 2 88101217 missense unknown
R6736:Olfr1165-ps UTSW 2 88101603 missense probably benign 0.03
R7164:Olfr1165-ps UTSW 2 88101832 missense probably damaging 0.97
R7285:Olfr1165-ps UTSW 2 88101705 missense probably damaging 1.00
R7807:Olfr1165-ps UTSW 2 88101565 missense probably benign 0.00
R8040:Olfr1165-ps UTSW 2 88101359 missense unknown
R8509:Olfr1165-ps UTSW 2 88101522 missense probably benign 0.16
R9047:Olfr1165-ps UTSW 2 88101072 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGAGTCCACCCTTAGAAGG -3'
(R):5'- GGAGGACAGGACAATCTCTTTC -3'

Sequencing Primer
(F):5'- GTCCACCCTTAGAAGGCATCTTAATG -3'
(R):5'- CAGGACAATCTCTTTCAAAGGATGC -3'
Posted On 2016-06-06