Incidental Mutation 'R5078:Kif18a'
ID386950
Institutional Source Beutler Lab
Gene Symbol Kif18a
Ensembl Gene ENSMUSG00000027115
Gene Namekinesin family member 18A
SynonymsB130001M12Rik, N-8 kinesin
MMRRC Submission 042667-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5078 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location109280738-109341747 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 109295142 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028527]
Predicted Effect probably benign
Transcript: ENSMUST00000028527
SMART Domains Protein: ENSMUSP00000028527
Gene: ENSMUSG00000027115

DomainStartEndE-ValueType
KISc 9 363 8.91e-158 SMART
Blast:KISc 382 433 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162515
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KIF18A is a member of the kinesin superfamily of microtubule-associated molecular motors (see MIM 148760) that use hydrolysis of ATP to produce force and movement along microtubules (Luboshits and Benayahu, 2005 [PubMed 15878648]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for loss of function alleles exhibit reduced female fertility and male infertility due to primordial germ cell depletion. The sterility phenotype is incompletely penetrant, has variable expressivity, and is modulated by strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,323,907 S345G probably benign Het
Adgrf2 A T 17: 42,710,986 F316I probably damaging Het
Ank2 A G 3: 126,942,353 probably benign Het
Auts2 T C 5: 132,258,947 K66E possibly damaging Het
Bicra T C 7: 15,975,457 D1144G probably damaging Het
Cabin1 A G 10: 75,721,478 S1109P probably damaging Het
Camkv T C 9: 107,945,373 V29A probably damaging Het
Ccdc178 A T 18: 22,067,628 probably null Het
Ccser1 G A 6: 61,311,366 R171H probably damaging Het
Cdk19 A G 10: 40,436,154 Y133C probably damaging Het
Cerkl T A 2: 79,393,008 D123V probably benign Het
Chd1 T C 17: 15,726,354 S121P possibly damaging Het
Col4a2 T C 8: 11,443,936 V1459A probably benign Het
Dlg1 T A 16: 31,856,469 Y704* probably null Het
Dsg2 T C 18: 20,596,083 probably null Het
Egln3 T C 12: 54,181,667 R218G probably damaging Het
Gm11568 T C 11: 99,858,355 C129R unknown Het
Gm13991 T C 2: 116,527,874 noncoding transcript Het
Gmnc C A 16: 26,965,582 V58L probably benign Het
Gpx5 A G 13: 21,288,711 F151S probably damaging Het
Helz G A 11: 107,656,096 G1079R probably damaging Het
Ice1 T C 13: 70,604,850 E1039G probably benign Het
Klhl29 T C 12: 5,093,530 T500A possibly damaging Het
Lrfn5 A C 12: 61,843,874 K650Q possibly damaging Het
Lrp2 T C 2: 69,501,530 D1627G possibly damaging Het
Nxn T C 11: 76,261,607 K354E probably damaging Het
Olfr1165-ps T A 2: 88,101,535 I151L probably benign Het
Pcnx2 T C 8: 125,752,156 T2118A probably benign Het
Phldb2 A G 16: 45,777,742 F861L possibly damaging Het
Piezo2 A G 18: 63,024,536 Y2368H probably damaging Het
Pnp T A 14: 50,951,506 L252* probably null Het
Prom2 T C 2: 127,531,837 Q641R probably benign Het
Prpf31 T C 7: 3,634,703 S180P possibly damaging Het
Prss27 C A 17: 24,044,440 Y142* probably null Het
Ripk1 T G 13: 34,017,099 M265R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ropn1 T A 16: 34,666,791 D32E probably damaging Het
Rps23 T C 13: 90,923,703 F41L probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Selenot C T 3: 58,585,271 R60W probably damaging Het
Tll1 T C 8: 64,093,887 K342E probably damaging Het
Tlx1 A T 19: 45,156,021 N61Y probably damaging Het
Vmn2r117 T A 17: 23,460,148 I701F probably damaging Het
Zmynd12 A G 4: 119,444,850 K229E probably damaging Het
Other mutations in Kif18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Kif18a APN 2 109317988 missense possibly damaging 0.93
IGL00795:Kif18a APN 2 109293020 missense probably damaging 1.00
IGL00904:Kif18a APN 2 109292126 missense probably damaging 1.00
IGL00990:Kif18a APN 2 109334422 missense probably benign 0.01
IGL01323:Kif18a APN 2 109298442 missense probably benign 0.02
IGL01382:Kif18a APN 2 109296766 nonsense probably null
IGL02205:Kif18a APN 2 109307018 splice site probably benign
IGL02207:Kif18a APN 2 109296707 missense probably damaging 0.99
IGL02970:Kif18a APN 2 109287888 missense probably damaging 1.00
IGL03087:Kif18a APN 2 109318117 splice site probably benign
R0030:Kif18a UTSW 2 109333318 missense probably benign
R0482:Kif18a UTSW 2 109287843 start codon destroyed probably null 1.00
R0631:Kif18a UTSW 2 109298322 splice site probably benign
R1597:Kif18a UTSW 2 109292991 missense probably damaging 1.00
R1640:Kif18a UTSW 2 109289816 missense probably benign 0.25
R1675:Kif18a UTSW 2 109298403 missense probably benign
R1723:Kif18a UTSW 2 109302882 missense probably damaging 1.00
R2141:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2142:Kif18a UTSW 2 109333503 missense probably benign 0.43
R2243:Kif18a UTSW 2 109298107 missense probably damaging 1.00
R3609:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3611:Kif18a UTSW 2 109338596 missense probably benign 0.02
R3882:Kif18a UTSW 2 109306974 missense probably benign 0.01
R4292:Kif18a UTSW 2 109298126 missense probably damaging 0.99
R4293:Kif18a UTSW 2 109293053 missense probably benign
R4294:Kif18a UTSW 2 109293053 missense probably benign
R4295:Kif18a UTSW 2 109293053 missense probably benign
R4428:Kif18a UTSW 2 109288121 missense probably damaging 1.00
R4791:Kif18a UTSW 2 109287875 missense probably benign 0.16
R4819:Kif18a UTSW 2 109292126 missense probably damaging 1.00
R5175:Kif18a UTSW 2 109302978 splice site probably null
R5319:Kif18a UTSW 2 109318025 missense probably benign 0.00
R5821:Kif18a UTSW 2 109289845 splice site probably benign
R5966:Kif18a UTSW 2 109292066 missense probably damaging 1.00
R6886:Kif18a UTSW 2 109296663 missense probably damaging 1.00
R7069:Kif18a UTSW 2 109295002 missense probably damaging 0.99
R7765:Kif18a UTSW 2 109306940 missense probably benign 0.00
R7801:Kif18a UTSW 2 109287845 missense probably damaging 0.99
R7834:Kif18a UTSW 2 109296774 missense probably damaging 1.00
R8442:Kif18a UTSW 2 109294973 missense possibly damaging 0.68
R8510:Kif18a UTSW 2 109296764 missense probably damaging 1.00
Z1176:Kif18a UTSW 2 109318053 missense possibly damaging 0.63
Z1177:Kif18a UTSW 2 109294957 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAGCATCAATCAAAATGTCC -3'
(R):5'- TGGCTATCTGAAAGAAAAGCAACC -3'

Sequencing Primer
(F):5'- TGTCCGTATAGCCAAAATGTCACTC -3'
(R):5'- CTAGCACACATGAGGTACTGGGTTC -3'
Posted On2016-06-06