Mutagenetix > Incidental Mutation

Incidental Mutation 'R5078:Sec24d'

386955

Institutional Source

Beutler Lab

Gene Symbol

Sec24d

Ensembl Gene

ENSMUSG00000039234

Gene Name

Sec24 related gene family, member D (S. cerevisiae)

Synonyms

2310020L09Rik, LOC383951

MMRRC Submission

042667-MU

Accession Numbers

Genbank: NM_027135; MGI: 1916858

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

123267455-123365641 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123290552 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 127 (I127V)

Ref Sequence

ENSEMBL: ENSMUSP00000035823 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047923]

AlphaFold

Q6NXL1

Predicted Effect

probably benign
Transcript: ENSMUST00000047923
AA Change: I127V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000035823
Gene: ENSMUSG00000039234
AA Change: I127V

Domain	Start	End	E-Value	Type
low complexity region	46	71	N/A	INTRINSIC
low complexity region	75	87	N/A	INTRINSIC
low complexity region	136	160	N/A	INTRINSIC
low complexity region	197	222	N/A	INTRINSIC
low complexity region	238	256	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	360	398	1.8e-16	PFAM
Pfam:Sec23_trunk	437	681	3.6e-88	PFAM
Pfam:Sec23_BS	686	770	2e-20	PFAM
Pfam:Sec23_helical	783	884	1e-27	PFAM
Pfam:Gelsolin	899	974	4.2e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197291

Meta Mutation Damage Score

0.0638

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. This gene product is implicated in the shaping of the vesicle, and also in cargo selection and concentration. Mutations in this gene have been associated with Cole-Carpenter syndrome, a disorder affecting bone formation, resulting in craniofacial malformations and bones that break easily. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. A hypomorphic gene trap allele results in lethality during organogenesis. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	T	C	16: 4,323,907	S345G	probably benign	Het
Adgrf2	A	T	17: 42,710,986	F316I	probably damaging	Het
Ank2	A	G	3: 126,942,353		probably benign	Het
Auts2	T	C	5: 132,258,947	K66E	possibly damaging	Het
Bicra	T	C	7: 15,975,457	D1144G	probably damaging	Het
Cabin1	A	G	10: 75,721,478	S1109P	probably damaging	Het
Camkv	T	C	9: 107,945,373	V29A	probably damaging	Het
Ccdc178	A	T	18: 22,067,628		probably null	Het
Ccser1	G	A	6: 61,311,366	R171H	probably damaging	Het
Cdk19	A	G	10: 40,436,154	Y133C	probably damaging	Het
Cerkl	T	A	2: 79,393,008	D123V	probably benign	Het
Chd1	T	C	17: 15,726,354	S121P	possibly damaging	Het
Col4a2	T	C	8: 11,443,936	V1459A	probably benign	Het
Dlg1	T	A	16: 31,856,469	Y704*	probably null	Het
Dsg2	T	C	18: 20,596,083		probably null	Het
Egln3	T	C	12: 54,181,667	R218G	probably damaging	Het
Gm11568	T	C	11: 99,858,355	C129R	unknown	Het
Gm13991	T	C	2: 116,527,874		noncoding transcript	Het
Gmnc	C	A	16: 26,965,582	V58L	probably benign	Het
Gpx5	A	G	13: 21,288,711	F151S	probably damaging	Het
Helz	G	A	11: 107,656,096	G1079R	probably damaging	Het
Ice1	T	C	13: 70,604,850	E1039G	probably benign	Het
Kif18a	T	C	2: 109,295,142		probably benign	Het
Klhl29	T	C	12: 5,093,530	T500A	possibly damaging	Het
Lrfn5	A	C	12: 61,843,874	K650Q	possibly damaging	Het
Lrp2	T	C	2: 69,501,530	D1627G	possibly damaging	Het
Nxn	T	C	11: 76,261,607	K354E	probably damaging	Het
Olfr1165-ps	T	A	2: 88,101,535	I151L	probably benign	Het
Pcnx2	T	C	8: 125,752,156	T2118A	probably benign	Het
Phldb2	A	G	16: 45,777,742	F861L	possibly damaging	Het
Piezo2	A	G	18: 63,024,536	Y2368H	probably damaging	Het
Pnp	T	A	14: 50,951,506	L252*	probably null	Het
Prom2	T	C	2: 127,531,837	Q641R	probably benign	Het
Prpf31	T	C	7: 3,634,703	S180P	possibly damaging	Het
Prss27	C	A	17: 24,044,440	Y142*	probably null	Het
Ripk1	T	G	13: 34,017,099	M265R	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ropn1	T	A	16: 34,666,791	D32E	probably damaging	Het
Rps23	T	C	13: 90,923,703	F41L	probably benign	Het
Selenot	C	T	3: 58,585,271	R60W	probably damaging	Het
Tll1	T	C	8: 64,093,887	K342E	probably damaging	Het
Tlx1	A	T	19: 45,156,021	N61Y	probably damaging	Het
Vmn2r117	T	A	17: 23,460,148	I701F	probably damaging	Het
Zmynd12	A	G	4: 119,444,850	K229E	probably damaging	Het

Other mutations in Sec24d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01420:Sec24d	APN	3	123350009	missense	probably benign	0.00
IGL01621:Sec24d	APN	3	123294158	critical splice acceptor site	probably null
IGL01866:Sec24d	APN	3	123293595	nonsense	probably null
IGL02064:Sec24d	APN	3	123343814	splice site	probably benign
IGL02125:Sec24d	APN	3	123358958	missense	probably damaging	1.00
IGL02173:Sec24d	APN	3	123353681	missense	probably damaging	1.00
IGL03239:Sec24d	APN	3	123336489	missense	probably benign	0.00
Scanty	UTSW	3	123354947	missense	probably damaging	1.00
3-1:Sec24d	UTSW	3	123353630	missense	possibly damaging	0.94
PIT4531001:Sec24d	UTSW	3	123343178	missense	probably damaging	1.00
R0008:Sec24d	UTSW	3	123350876	splice site	probably benign
R0838:Sec24d	UTSW	3	123305836	missense	probably benign	0.08
R1775:Sec24d	UTSW	3	123336517	missense	probably damaging	1.00
R1895:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R1946:Sec24d	UTSW	3	123353394	missense	probably benign	0.04
R2238:Sec24d	UTSW	3	123349894	splice site	probably null
R2504:Sec24d	UTSW	3	123353606	missense	possibly damaging	0.69
R2846:Sec24d	UTSW	3	123350746	missense	probably damaging	0.98
R2895:Sec24d	UTSW	3	123343151	missense	probably damaging	1.00
R3428:Sec24d	UTSW	3	123343923	splice site	probably benign
R4573:Sec24d	UTSW	3	123358870	missense	probably damaging	1.00
R4668:Sec24d	UTSW	3	123355774	missense	probably damaging	0.98
R4706:Sec24d	UTSW	3	123355778	missense	possibly damaging	0.80
R4896:Sec24d	UTSW	3	123354947	missense	probably damaging	1.00
R4982:Sec24d	UTSW	3	123299606	missense	probably benign	0.29
R5030:Sec24d	UTSW	3	123358901	missense	probably damaging	0.98
R5041:Sec24d	UTSW	3	123294231	missense	probably damaging	0.96
R5108:Sec24d	UTSW	3	123305785	splice site	probably null
R5174:Sec24d	UTSW	3	123364926	missense	probably damaging	0.99
R5661:Sec24d	UTSW	3	123343085	missense	probably damaging	1.00
R5661:Sec24d	UTSW	3	123343142	missense	possibly damaging	0.95
R5775:Sec24d	UTSW	3	123290460	missense	probably benign	0.00
R5859:Sec24d	UTSW	3	123279312	unclassified	probably benign
R5944:Sec24d	UTSW	3	123293581	missense	probably benign	0.01
R6053:Sec24d	UTSW	3	123279222	nonsense	probably null
R6515:Sec24d	UTSW	3	123343070	missense	possibly damaging	0.92
R6552:Sec24d	UTSW	3	123290552	missense	probably benign	0.00
R6557:Sec24d	UTSW	3	123343087	missense	probably damaging	1.00
R6593:Sec24d	UTSW	3	123353412	missense	probably damaging	1.00
R6594:Sec24d	UTSW	3	123293763	missense	probably damaging	1.00
R6842:Sec24d	UTSW	3	123343219	missense	probably benign	0.00
R7072:Sec24d	UTSW	3	123330351	missense	probably damaging	1.00
R7481:Sec24d	UTSW	3	123350763	missense	probably damaging	1.00
R7554:Sec24d	UTSW	3	123355774	missense	probably damaging	1.00
R8270:Sec24d	UTSW	3	123305886	missense	possibly damaging	0.90
R8481:Sec24d	UTSW	3	123353424	missense	probably damaging	1.00
R8713:Sec24d	UTSW	3	123343892	missense	probably damaging	1.00
R8872:Sec24d	UTSW	3	123354936	splice site	probably benign
R8922:Sec24d	UTSW	3	123350839	missense	probably damaging	1.00
R8974:Sec24d	UTSW	3	123305849	missense	probably damaging	1.00
R9015:Sec24d	UTSW	3	123327638	missense	probably benign	0.43
R9050:Sec24d	UTSW	3	123350725	missense	probably benign	0.00
R9065:Sec24d	UTSW	3	123355803	missense	probably damaging	1.00
R9128:Sec24d	UTSW	3	123294161	missense	probably benign
R9447:Sec24d	UTSW	3	123290513	missense	probably benign	0.00
R9701:Sec24d	UTSW	3	123269672	missense	probably damaging	1.00
R9758:Sec24d	UTSW	3	123343154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACAGAGGACTTGTTTTAGGAC -3'
(R):5'- ATGCCCGAGTTATGTCTGCC -3'

Sequencing Primer
(F):5'- TGCTTAAGATGCTCAGTGATGCTATC -3'
(R):5'- TCTACGGTTCTGGGTTCA -3'

Posted On

2016-06-06