Mutagenetix > Incidental Mutation

Incidental Mutation 'R5078:Nxn'

386969

Institutional Source

Beutler Lab

Gene Symbol

Nxn

Ensembl Gene

ENSMUSG00000020844

Gene Name

nucleoredoxin

Synonyms

l11Jus13

MMRRC Submission

042667-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76257198-76399140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76261607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 354 (K354E)

Ref Sequence

ENSEMBL: ENSMUSP00000021204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021204]

AlphaFold

P97346

Predicted Effect

probably damaging
Transcript: ENSMUST00000021204
AA Change: K354E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021204
Gene: ENSMUSG00000020844
AA Change: K354E

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin_8	30	145	5.4e-23	PFAM
Pfam:AhpC-TSA	173	290	4.7e-10	PFAM
Pfam:Thioredoxin_2	189	296	7.1e-11	PFAM
Pfam:Thioredoxin_8	193	287	3.7e-32	PFAM
Pfam:Thioredoxin_6	236	424	8.4e-9	PFAM

Meta Mutation Damage Score

0.0883

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (53/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily, a group of small, multifunctional redox-active proteins. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. The encoded protein acts a redox-dependent regulator of the Wnt signaling pathway and is involved in cell growth and differentiation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice die by P1 and exhibit craniofacial bone defects and cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	T	C	16: 4,323,907	S345G	probably benign	Het
Adgrf2	A	T	17: 42,710,986	F316I	probably damaging	Het
Ank2	A	G	3: 126,942,353		probably benign	Het
Auts2	T	C	5: 132,258,947	K66E	possibly damaging	Het
Bicra	T	C	7: 15,975,457	D1144G	probably damaging	Het
Cabin1	A	G	10: 75,721,478	S1109P	probably damaging	Het
Camkv	T	C	9: 107,945,373	V29A	probably damaging	Het
Ccdc178	A	T	18: 22,067,628		probably null	Het
Ccser1	G	A	6: 61,311,366	R171H	probably damaging	Het
Cdk19	A	G	10: 40,436,154	Y133C	probably damaging	Het
Cerkl	T	A	2: 79,393,008	D123V	probably benign	Het
Chd1	T	C	17: 15,726,354	S121P	possibly damaging	Het
Col4a2	T	C	8: 11,443,936	V1459A	probably benign	Het
Dlg1	T	A	16: 31,856,469	Y704*	probably null	Het
Dsg2	T	C	18: 20,596,083		probably null	Het
Egln3	T	C	12: 54,181,667	R218G	probably damaging	Het
Gm11568	T	C	11: 99,858,355	C129R	unknown	Het
Gm13991	T	C	2: 116,527,874		noncoding transcript	Het
Gmnc	C	A	16: 26,965,582	V58L	probably benign	Het
Gpx5	A	G	13: 21,288,711	F151S	probably damaging	Het
Helz	G	A	11: 107,656,096	G1079R	probably damaging	Het
Ice1	T	C	13: 70,604,850	E1039G	probably benign	Het
Kif18a	T	C	2: 109,295,142		probably benign	Het
Klhl29	T	C	12: 5,093,530	T500A	possibly damaging	Het
Lrfn5	A	C	12: 61,843,874	K650Q	possibly damaging	Het
Lrp2	T	C	2: 69,501,530	D1627G	possibly damaging	Het
Olfr1165-ps	T	A	2: 88,101,535	I151L	probably benign	Het
Pcnx2	T	C	8: 125,752,156	T2118A	probably benign	Het
Phldb2	A	G	16: 45,777,742	F861L	possibly damaging	Het
Piezo2	A	G	18: 63,024,536	Y2368H	probably damaging	Het
Pnp	T	A	14: 50,951,506	L252*	probably null	Het
Prom2	T	C	2: 127,531,837	Q641R	probably benign	Het
Prpf31	T	C	7: 3,634,703	S180P	possibly damaging	Het
Prss27	C	A	17: 24,044,440	Y142*	probably null	Het
Ripk1	T	G	13: 34,017,099	M265R	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ropn1	T	A	16: 34,666,791	D32E	probably damaging	Het
Rps23	T	C	13: 90,923,703	F41L	probably benign	Het
Sec24d	A	G	3: 123,290,552	I127V	probably benign	Het
Selenot	C	T	3: 58,585,271	R60W	probably damaging	Het
Tll1	T	C	8: 64,093,887	K342E	probably damaging	Het
Tlx1	A	T	19: 45,156,021	N61Y	probably damaging	Het
Vmn2r117	T	A	17: 23,460,148	I701F	probably damaging	Het
Zmynd12	A	G	4: 119,444,850	K229E	probably damaging	Het

Other mutations in Nxn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Nxn	APN	11	76274655	splice site	probably benign
IGL01780:Nxn	APN	11	76274654	splice site	probably benign
IGL02350:Nxn	APN	11	76274654	splice site	probably benign
IGL02357:Nxn	APN	11	76274654	splice site	probably benign
IGL02423:Nxn	APN	11	76274032	missense	probably benign	0.13
Charleston	UTSW	11	76263148	missense	possibly damaging	0.94
Flapper	UTSW	11	76278557	missense	probably damaging	1.00
BB006:Nxn	UTSW	11	76274037	missense	possibly damaging	0.93
BB016:Nxn	UTSW	11	76274037	missense	possibly damaging	0.93
R0098:Nxn	UTSW	11	76278594	splice site	probably benign
R0456:Nxn	UTSW	11	76263137	nonsense	probably null
R1127:Nxn	UTSW	11	76274069	nonsense	probably null
R1473:Nxn	UTSW	11	76263187	missense	possibly damaging	0.93
R1681:Nxn	UTSW	11	76272464	missense	probably benign	0.03
R1917:Nxn	UTSW	11	76261672	splice site	probably benign
R1918:Nxn	UTSW	11	76261672	splice site	probably benign
R2010:Nxn	UTSW	11	76398801	missense	probably damaging	0.99
R4501:Nxn	UTSW	11	76274612	missense	probably damaging	0.98
R4827:Nxn	UTSW	11	76261592	missense	probably benign	0.01
R5029:Nxn	UTSW	11	76274530	nonsense	probably null
R6403:Nxn	UTSW	11	76399020	missense	probably benign	0.22
R7088:Nxn	UTSW	11	76263148	missense	possibly damaging	0.94
R7478:Nxn	UTSW	11	76261552	missense	probably damaging	0.97
R7642:Nxn	UTSW	11	76272459	missense	probably damaging	1.00
R7830:Nxn	UTSW	11	76273993	missense	probably damaging	1.00
R7929:Nxn	UTSW	11	76274037	missense	possibly damaging	0.93
R8397:Nxn	UTSW	11	76272406	missense	probably damaging	1.00
R8478:Nxn	UTSW	11	76274043	missense	probably damaging	0.98
R9032:Nxn	UTSW	11	76278557	missense	probably damaging	1.00
R9122:Nxn	UTSW	11	76278491	missense	probably damaging	0.98
R9173:Nxn	UTSW	11	76258734	missense	possibly damaging	0.96
R9725:Nxn	UTSW	11	76278536	missense	probably damaging	0.98
X0062:Nxn	UTSW	11	76263152	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GTTTCTGATGACTAAGGGCACAC -3'
(R):5'- AGGGTTCGAACTGCTCACTG -3'

Sequencing Primer
(F):5'- TCTTACATCTGCGTGTGGC -3'
(R):5'- CTCACTGAGCTGTTTGTGTCTAG -3'

Posted On

2016-06-06