Incidental Mutation 'R5078:Nxn'
ID 386969
Institutional Source Beutler Lab
Gene Symbol Nxn
Ensembl Gene ENSMUSG00000020844
Gene Name nucleoredoxin
Synonyms l11Jus13
MMRRC Submission 042667-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5078 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 76257198-76399140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76261607 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 354 (K354E)
Ref Sequence ENSEMBL: ENSMUSP00000021204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021204]
AlphaFold P97346
Predicted Effect probably damaging
Transcript: ENSMUST00000021204
AA Change: K354E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021204
Gene: ENSMUSG00000020844
AA Change: K354E

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 30 145 5.4e-23 PFAM
Pfam:AhpC-TSA 173 290 4.7e-10 PFAM
Pfam:Thioredoxin_2 189 296 7.1e-11 PFAM
Pfam:Thioredoxin_8 193 287 3.7e-32 PFAM
Pfam:Thioredoxin_6 236 424 8.4e-9 PFAM
Meta Mutation Damage Score 0.0883 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin superfamily, a group of small, multifunctional redox-active proteins. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. The encoded protein acts a redox-dependent regulator of the Wnt signaling pathway and is involved in cell growth and differentiation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice die by P1 and exhibit craniofacial bone defects and cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,323,907 S345G probably benign Het
Adgrf2 A T 17: 42,710,986 F316I probably damaging Het
Ank2 A G 3: 126,942,353 probably benign Het
Auts2 T C 5: 132,258,947 K66E possibly damaging Het
Bicra T C 7: 15,975,457 D1144G probably damaging Het
Cabin1 A G 10: 75,721,478 S1109P probably damaging Het
Camkv T C 9: 107,945,373 V29A probably damaging Het
Ccdc178 A T 18: 22,067,628 probably null Het
Ccser1 G A 6: 61,311,366 R171H probably damaging Het
Cdk19 A G 10: 40,436,154 Y133C probably damaging Het
Cerkl T A 2: 79,393,008 D123V probably benign Het
Chd1 T C 17: 15,726,354 S121P possibly damaging Het
Col4a2 T C 8: 11,443,936 V1459A probably benign Het
Dlg1 T A 16: 31,856,469 Y704* probably null Het
Dsg2 T C 18: 20,596,083 probably null Het
Egln3 T C 12: 54,181,667 R218G probably damaging Het
Gm11568 T C 11: 99,858,355 C129R unknown Het
Gm13991 T C 2: 116,527,874 noncoding transcript Het
Gmnc C A 16: 26,965,582 V58L probably benign Het
Gpx5 A G 13: 21,288,711 F151S probably damaging Het
Helz G A 11: 107,656,096 G1079R probably damaging Het
Ice1 T C 13: 70,604,850 E1039G probably benign Het
Kif18a T C 2: 109,295,142 probably benign Het
Klhl29 T C 12: 5,093,530 T500A possibly damaging Het
Lrfn5 A C 12: 61,843,874 K650Q possibly damaging Het
Lrp2 T C 2: 69,501,530 D1627G possibly damaging Het
Olfr1165-ps T A 2: 88,101,535 I151L probably benign Het
Pcnx2 T C 8: 125,752,156 T2118A probably benign Het
Phldb2 A G 16: 45,777,742 F861L possibly damaging Het
Piezo2 A G 18: 63,024,536 Y2368H probably damaging Het
Pnp T A 14: 50,951,506 L252* probably null Het
Prom2 T C 2: 127,531,837 Q641R probably benign Het
Prpf31 T C 7: 3,634,703 S180P possibly damaging Het
Prss27 C A 17: 24,044,440 Y142* probably null Het
Ripk1 T G 13: 34,017,099 M265R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ropn1 T A 16: 34,666,791 D32E probably damaging Het
Rps23 T C 13: 90,923,703 F41L probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Selenot C T 3: 58,585,271 R60W probably damaging Het
Tll1 T C 8: 64,093,887 K342E probably damaging Het
Tlx1 A T 19: 45,156,021 N61Y probably damaging Het
Vmn2r117 T A 17: 23,460,148 I701F probably damaging Het
Zmynd12 A G 4: 119,444,850 K229E probably damaging Het
Other mutations in Nxn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Nxn APN 11 76274655 splice site probably benign
IGL01780:Nxn APN 11 76274654 splice site probably benign
IGL02350:Nxn APN 11 76274654 splice site probably benign
IGL02357:Nxn APN 11 76274654 splice site probably benign
IGL02423:Nxn APN 11 76274032 missense probably benign 0.13
Charleston UTSW 11 76263148 missense possibly damaging 0.94
Flapper UTSW 11 76278557 missense probably damaging 1.00
BB006:Nxn UTSW 11 76274037 missense possibly damaging 0.93
BB016:Nxn UTSW 11 76274037 missense possibly damaging 0.93
R0098:Nxn UTSW 11 76278594 splice site probably benign
R0456:Nxn UTSW 11 76263137 nonsense probably null
R1127:Nxn UTSW 11 76274069 nonsense probably null
R1473:Nxn UTSW 11 76263187 missense possibly damaging 0.93
R1681:Nxn UTSW 11 76272464 missense probably benign 0.03
R1917:Nxn UTSW 11 76261672 splice site probably benign
R1918:Nxn UTSW 11 76261672 splice site probably benign
R2010:Nxn UTSW 11 76398801 missense probably damaging 0.99
R4501:Nxn UTSW 11 76274612 missense probably damaging 0.98
R4827:Nxn UTSW 11 76261592 missense probably benign 0.01
R5029:Nxn UTSW 11 76274530 nonsense probably null
R6403:Nxn UTSW 11 76399020 missense probably benign 0.22
R7088:Nxn UTSW 11 76263148 missense possibly damaging 0.94
R7478:Nxn UTSW 11 76261552 missense probably damaging 0.97
R7642:Nxn UTSW 11 76272459 missense probably damaging 1.00
R7830:Nxn UTSW 11 76273993 missense probably damaging 1.00
R7929:Nxn UTSW 11 76274037 missense possibly damaging 0.93
R8397:Nxn UTSW 11 76272406 missense probably damaging 1.00
R8478:Nxn UTSW 11 76274043 missense probably damaging 0.98
R9032:Nxn UTSW 11 76278557 missense probably damaging 1.00
R9122:Nxn UTSW 11 76278491 missense probably damaging 0.98
R9173:Nxn UTSW 11 76258734 missense possibly damaging 0.96
R9725:Nxn UTSW 11 76278536 missense probably damaging 0.98
X0062:Nxn UTSW 11 76263152 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GTTTCTGATGACTAAGGGCACAC -3'
(R):5'- AGGGTTCGAACTGCTCACTG -3'

Sequencing Primer
(F):5'- TCTTACATCTGCGTGTGGC -3'
(R):5'- CTCACTGAGCTGTTTGTGTCTAG -3'
Posted On 2016-06-06