Incidental Mutation 'R5078:Helz'
ID386972
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission 042667-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5078 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107656096 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1079 (G1079R)
Ref Sequence ENSEMBL: ENSMUSP00000102357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746] [ENSMUST00000133862]
Predicted Effect probably damaging
Transcript: ENSMUST00000075012
AA Change: G1080R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: G1080R

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100305
AA Change: G1079R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: G1079R

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106746
AA Change: G1079R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: G1079R

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133862
AA Change: G398R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117498
Gene: ENSMUSG00000020721
AA Change: G398R

DomainStartEndE-ValueType
Pfam:AAA_11 68 152 2.1e-19 PFAM
Pfam:AAA_12 159 371 1.5e-36 PFAM
low complexity region 483 494 N/A INTRINSIC
low complexity region 678 766 N/A INTRINSIC
low complexity region 784 805 N/A INTRINSIC
low complexity region 875 886 N/A INTRINSIC
Meta Mutation Damage Score 0.1246 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,323,907 S345G probably benign Het
Adgrf2 A T 17: 42,710,986 F316I probably damaging Het
Ank2 A G 3: 126,942,353 probably benign Het
Auts2 T C 5: 132,258,947 K66E possibly damaging Het
Bicra T C 7: 15,975,457 D1144G probably damaging Het
Cabin1 A G 10: 75,721,478 S1109P probably damaging Het
Camkv T C 9: 107,945,373 V29A probably damaging Het
Ccdc178 A T 18: 22,067,628 probably null Het
Ccser1 G A 6: 61,311,366 R171H probably damaging Het
Cdk19 A G 10: 40,436,154 Y133C probably damaging Het
Cerkl T A 2: 79,393,008 D123V probably benign Het
Chd1 T C 17: 15,726,354 S121P possibly damaging Het
Col4a2 T C 8: 11,443,936 V1459A probably benign Het
Dlg1 T A 16: 31,856,469 Y704* probably null Het
Dsg2 T C 18: 20,596,083 probably null Het
Egln3 T C 12: 54,181,667 R218G probably damaging Het
Gm11568 T C 11: 99,858,355 C129R unknown Het
Gm13991 T C 2: 116,527,874 noncoding transcript Het
Gmnc C A 16: 26,965,582 V58L probably benign Het
Gpx5 A G 13: 21,288,711 F151S probably damaging Het
Ice1 T C 13: 70,604,850 E1039G probably benign Het
Kif18a T C 2: 109,295,142 probably benign Het
Klhl29 T C 12: 5,093,530 T500A possibly damaging Het
Lrfn5 A C 12: 61,843,874 K650Q possibly damaging Het
Lrp2 T C 2: 69,501,530 D1627G possibly damaging Het
Nxn T C 11: 76,261,607 K354E probably damaging Het
Olfr1165-ps T A 2: 88,101,535 I151L probably benign Het
Pcnx2 T C 8: 125,752,156 T2118A probably benign Het
Phldb2 A G 16: 45,777,742 F861L possibly damaging Het
Piezo2 A G 18: 63,024,536 Y2368H probably damaging Het
Pnp T A 14: 50,951,506 L252* probably null Het
Prom2 T C 2: 127,531,837 Q641R probably benign Het
Prpf31 T C 7: 3,634,703 S180P possibly damaging Het
Prss27 C A 17: 24,044,440 Y142* probably null Het
Ripk1 T G 13: 34,017,099 M265R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ropn1 T A 16: 34,666,791 D32E probably damaging Het
Rps23 T C 13: 90,923,703 F41L probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Selenot C T 3: 58,585,271 R60W probably damaging Het
Tll1 T C 8: 64,093,887 K342E probably damaging Het
Tlx1 A T 19: 45,156,021 N61Y probably damaging Het
Vmn2r117 T A 17: 23,460,148 I701F probably damaging Het
Zmynd12 A G 4: 119,444,850 K229E probably damaging Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0328:Helz UTSW 11 107604348 missense probably benign 0.30
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R8024:Helz UTSW 11 107686421 missense unknown
R8181:Helz UTSW 11 107672573 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGATGGGTGATGGGCTACAAG -3'
(R):5'- TAAAGCAGGGCCTTTACCTTG -3'

Sequencing Primer
(F):5'- GCAGTGGGCAGAATTTG -3'
(R):5'- CCTTTACCTTGGGTGGTGAC -3'
Posted On2016-06-06