Mutagenetix > Incidental Mutations

Incidental Mutation 'R5078:Ice1'

386978

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

042667-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.935) question?

Stock #

R5078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70604850 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1039 (E1039G)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]

AlphaFold

E9Q286

Predicted Effect

probably benign
Transcript: ENSMUST00000043493
AA Change: E1039G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: E1039G

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

probably benign
Transcript: ENSMUST00000222568

Predicted Effect

probably benign
Transcript: ENSMUST00000222627

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy9	T	C	16: 4,323,907	S345G	probably benign	Het
Adgrf2	A	T	17: 42,710,986	F316I	probably damaging	Het
Ank2	A	G	3: 126,942,353		probably benign	Het
Auts2	T	C	5: 132,258,947	K66E	possibly damaging	Het
Bicra	T	C	7: 15,975,457	D1144G	probably damaging	Het
Cabin1	A	G	10: 75,721,478	S1109P	probably damaging	Het
Camkv	T	C	9: 107,945,373	V29A	probably damaging	Het
Ccdc178	A	T	18: 22,067,628		probably null	Het
Ccser1	G	A	6: 61,311,366	R171H	probably damaging	Het
Cdk19	A	G	10: 40,436,154	Y133C	probably damaging	Het
Cerkl	T	A	2: 79,393,008	D123V	probably benign	Het
Chd1	T	C	17: 15,726,354	S121P	possibly damaging	Het
Col4a2	T	C	8: 11,443,936	V1459A	probably benign	Het
Dlg1	T	A	16: 31,856,469	Y704*	probably null	Het
Dsg2	T	C	18: 20,596,083		probably null	Het
Egln3	T	C	12: 54,181,667	R218G	probably damaging	Het
Gm11568	T	C	11: 99,858,355	C129R	unknown	Het
Gm13991	T	C	2: 116,527,874		noncoding transcript	Het
Gmnc	C	A	16: 26,965,582	V58L	probably benign	Het
Gpx5	A	G	13: 21,288,711	F151S	probably damaging	Het
Helz	G	A	11: 107,656,096	G1079R	probably damaging	Het
Kif18a	T	C	2: 109,295,142		probably benign	Het
Klhl29	T	C	12: 5,093,530	T500A	possibly damaging	Het
Lrfn5	A	C	12: 61,843,874	K650Q	possibly damaging	Het
Lrp2	T	C	2: 69,501,530	D1627G	possibly damaging	Het
Nxn	T	C	11: 76,261,607	K354E	probably damaging	Het
Olfr1165-ps	T	A	2: 88,101,535	I151L	probably benign	Het
Pcnx2	T	C	8: 125,752,156	T2118A	probably benign	Het
Phldb2	A	G	16: 45,777,742	F861L	possibly damaging	Het
Piezo2	A	G	18: 63,024,536	Y2368H	probably damaging	Het
Pnp	T	A	14: 50,951,506	L252*	probably null	Het
Prom2	T	C	2: 127,531,837	Q641R	probably benign	Het
Prpf31	T	C	7: 3,634,703	S180P	possibly damaging	Het
Prss27	C	A	17: 24,044,440	Y142*	probably null	Het
Ripk1	T	G	13: 34,017,099	M265R	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ropn1	T	A	16: 34,666,791	D32E	probably damaging	Het
Rps23	T	C	13: 90,923,703	F41L	probably benign	Het
Sec24d	A	G	3: 123,290,552	I127V	probably benign	Het
Selenot	C	T	3: 58,585,271	R60W	probably damaging	Het
Tll1	T	C	8: 64,093,887	K342E	probably damaging	Het
Tlx1	A	T	19: 45,156,021	N61Y	probably damaging	Het
Vmn2r117	T	A	17: 23,460,148	I701F	probably damaging	Het
Zmynd12	A	G	4: 119,444,850	K229E	probably damaging	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R6917:Ice1	UTSW	13	70594894	missense	probably damaging	1.00
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
R8887:Ice1	UTSW	13	70602931	missense	probably damaging	1.00
R8911:Ice1	UTSW	13	70592668	missense
R8954:Ice1	UTSW	13	70610578	missense	probably damaging	1.00
R9345:Ice1	UTSW	13	70592639	missense
R9438:Ice1	UTSW	13	70606315	missense	probably benign	0.04
R9452:Ice1	UTSW	13	70596343	missense	probably damaging	1.00
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGTCTATGTGAGTCTTCCG -3'
(R):5'- ACACAGTCAGGTGCCAGTAG -3'

Sequencing Primer
(F):5'- ATGTGAGTCTTCCGCTTGC -3'
(R):5'- GTGACATCGGGAGTCTTCC -3'

Posted On

2016-06-06