Incidental Mutation 'R5078:Chd1'
ID 386987
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
MMRRC Submission 042667-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5078 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 15925229-15992872 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15946616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 121 (S121P)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
AlphaFold P40201
Predicted Effect possibly damaging
Transcript: ENSMUST00000024627
AA Change: S121P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: S121P

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173159
Predicted Effect possibly damaging
Transcript: ENSMUST00000173311
AA Change: S121P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: S121P

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,141,771 (GRCm39) S345G probably benign Het
Adgrf2 A T 17: 43,021,877 (GRCm39) F316I probably damaging Het
Ank2 A G 3: 126,736,002 (GRCm39) probably benign Het
Auts2 T C 5: 132,287,786 (GRCm39) K66E possibly damaging Het
Bicra T C 7: 15,709,382 (GRCm39) D1144G probably damaging Het
Cabin1 A G 10: 75,557,312 (GRCm39) S1109P probably damaging Het
Camkv T C 9: 107,822,572 (GRCm39) V29A probably damaging Het
Ccdc178 A T 18: 22,200,685 (GRCm39) probably null Het
Ccser1 G A 6: 61,288,350 (GRCm39) R171H probably damaging Het
Cdk19 A G 10: 40,312,150 (GRCm39) Y133C probably damaging Het
Cerkl T A 2: 79,223,352 (GRCm39) D123V probably benign Het
Col4a2 T C 8: 11,493,936 (GRCm39) V1459A probably benign Het
Dlg1 T A 16: 31,675,287 (GRCm39) Y704* probably null Het
Dsg2 T C 18: 20,729,140 (GRCm39) probably null Het
Egln3 T C 12: 54,228,453 (GRCm39) R218G probably damaging Het
Gm11568 T C 11: 99,749,181 (GRCm39) C129R unknown Het
Gm13991 T C 2: 116,358,355 (GRCm39) noncoding transcript Het
Gmnc C A 16: 26,784,332 (GRCm39) V58L probably benign Het
Gpx5 A G 13: 21,472,881 (GRCm39) F151S probably damaging Het
Helz G A 11: 107,546,922 (GRCm39) G1079R probably damaging Het
Ice1 T C 13: 70,752,969 (GRCm39) E1039G probably benign Het
Kif18a T C 2: 109,125,487 (GRCm39) probably benign Het
Klhl29 T C 12: 5,143,530 (GRCm39) T500A possibly damaging Het
Lrfn5 A C 12: 61,890,660 (GRCm39) K650Q possibly damaging Het
Lrp2 T C 2: 69,331,874 (GRCm39) D1627G possibly damaging Het
Nxn T C 11: 76,152,433 (GRCm39) K354E probably damaging Het
Or5d20-ps1 T A 2: 87,931,879 (GRCm39) I151L probably benign Het
Pcnx2 T C 8: 126,478,895 (GRCm39) T2118A probably benign Het
Phldb2 A G 16: 45,598,105 (GRCm39) F861L possibly damaging Het
Piezo2 A G 18: 63,157,607 (GRCm39) Y2368H probably damaging Het
Pnp T A 14: 51,188,963 (GRCm39) L252* probably null Het
Prom2 T C 2: 127,373,757 (GRCm39) Q641R probably benign Het
Prpf31 T C 7: 3,637,702 (GRCm39) S180P possibly damaging Het
Prss27 C A 17: 24,263,414 (GRCm39) Y142* probably null Het
Ripk1 T G 13: 34,201,082 (GRCm39) M265R probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Ropn1 T A 16: 34,487,161 (GRCm39) D32E probably damaging Het
Rps23 T C 13: 91,071,822 (GRCm39) F41L probably benign Het
Sec24d A G 3: 123,084,201 (GRCm39) I127V probably benign Het
Selenot C T 3: 58,492,692 (GRCm39) R60W probably damaging Het
Tll1 T C 8: 64,546,921 (GRCm39) K342E probably damaging Het
Tlx1 A T 19: 45,144,460 (GRCm39) N61Y probably damaging Het
Vmn2r117 T A 17: 23,679,122 (GRCm39) I701F probably damaging Het
Zmynd12 A G 4: 119,302,047 (GRCm39) K229E probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15,952,827 (GRCm39) missense probably benign 0.37
IGL01356:Chd1 APN 17 15,970,127 (GRCm39) missense probably damaging 1.00
IGL01369:Chd1 APN 17 15,975,259 (GRCm39) missense probably damaging 0.97
IGL01519:Chd1 APN 17 17,598,831 (GRCm39) missense probably damaging 1.00
IGL01604:Chd1 APN 17 15,990,359 (GRCm39) missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17,598,858 (GRCm39) missense probably damaging 1.00
IGL01721:Chd1 APN 17 15,990,430 (GRCm39) missense probably damaging 1.00
IGL01959:Chd1 APN 17 15,962,435 (GRCm39) missense probably damaging 1.00
IGL02367:Chd1 APN 17 17,610,315 (GRCm39) missense probably damaging 0.98
IGL02476:Chd1 APN 17 15,954,535 (GRCm39) missense probably damaging 1.00
IGL02756:Chd1 APN 17 15,951,069 (GRCm39) missense probably damaging 0.97
IGL02817:Chd1 APN 17 15,969,762 (GRCm39) missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15,990,560 (GRCm39) missense probably benign 0.22
IGL03108:Chd1 APN 17 15,945,543 (GRCm39) missense possibly damaging 0.70
Holly UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0128:Chd1 UTSW 17 17,613,829 (GRCm39) missense probably damaging 1.00
R0197:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0285:Chd1 UTSW 17 17,594,942 (GRCm39) splice site probably benign
R0326:Chd1 UTSW 17 15,988,830 (GRCm39) missense probably benign
R0326:Chd1 UTSW 17 15,988,828 (GRCm39) missense probably damaging 1.00
R0372:Chd1 UTSW 17 17,607,552 (GRCm39) missense probably benign 0.14
R0391:Chd1 UTSW 17 15,970,156 (GRCm39) missense probably damaging 1.00
R0486:Chd1 UTSW 17 15,954,604 (GRCm39) missense probably damaging 0.99
R0637:Chd1 UTSW 17 15,962,550 (GRCm39) missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15,978,523 (GRCm39) unclassified probably benign
R0701:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0788:Chd1 UTSW 17 15,927,376 (GRCm39) missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15,990,503 (GRCm39) missense probably damaging 1.00
R0883:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R1169:Chd1 UTSW 17 15,955,994 (GRCm39) missense probably damaging 1.00
R1218:Chd1 UTSW 17 15,945,574 (GRCm39) missense probably damaging 1.00
R1370:Chd1 UTSW 17 17,607,742 (GRCm39) missense probably benign 0.00
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15,959,769 (GRCm39) missense probably damaging 0.99
R1752:Chd1 UTSW 17 15,963,494 (GRCm39) critical splice donor site probably null
R1759:Chd1 UTSW 17 17,607,533 (GRCm39) missense probably benign 0.00
R1767:Chd1 UTSW 17 15,990,565 (GRCm39) missense probably damaging 1.00
R1938:Chd1 UTSW 17 15,982,748 (GRCm39) missense probably benign 0.39
R2007:Chd1 UTSW 17 15,951,268 (GRCm39) missense probably damaging 1.00
R2069:Chd1 UTSW 17 15,962,556 (GRCm39) missense probably damaging 1.00
R3771:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3773:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3849:Chd1 UTSW 17 15,952,133 (GRCm39) missense probably damaging 1.00
R4241:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4242:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4354:Chd1 UTSW 17 17,610,263 (GRCm39) missense probably benign 0.23
R4468:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4469:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4731:Chd1 UTSW 17 17,598,079 (GRCm39) missense probably benign 0.36
R4824:Chd1 UTSW 17 15,953,386 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,016 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,015 (GRCm39) nonsense probably null
R4880:Chd1 UTSW 17 17,594,916 (GRCm39) missense probably damaging 1.00
R4960:Chd1 UTSW 17 15,962,493 (GRCm39) missense probably damaging 0.96
R5071:Chd1 UTSW 17 15,982,667 (GRCm39) missense probably benign
R5114:Chd1 UTSW 17 15,948,460 (GRCm39) missense probably benign 0.25
R5268:Chd1 UTSW 17 15,956,005 (GRCm39) missense probably damaging 1.00
R5304:Chd1 UTSW 17 15,990,530 (GRCm39) missense possibly damaging 0.55
R5304:Chd1 UTSW 17 15,975,213 (GRCm39) missense probably benign 0.01
R5307:Chd1 UTSW 17 15,952,832 (GRCm39) missense probably damaging 1.00
R5458:Chd1 UTSW 17 15,958,811 (GRCm39) missense probably damaging 1.00
R5553:Chd1 UTSW 17 17,605,875 (GRCm39) missense probably benign 0.17
R5623:Chd1 UTSW 17 15,975,194 (GRCm39) missense probably damaging 1.00
R6022:Chd1 UTSW 17 17,598,035 (GRCm39) missense probably benign 0.39
R6137:Chd1 UTSW 17 15,978,950 (GRCm39) missense probably damaging 1.00
R6257:Chd1 UTSW 17 15,950,465 (GRCm39) splice site probably null
R6373:Chd1 UTSW 17 15,958,898 (GRCm39) missense probably damaging 1.00
R6458:Chd1 UTSW 17 15,950,864 (GRCm39) missense probably benign 0.01
R6476:Chd1 UTSW 17 17,601,250 (GRCm39) critical splice donor site probably null
R6508:Chd1 UTSW 17 15,958,895 (GRCm39) missense probably benign 0.31
R6553:Chd1 UTSW 17 15,945,692 (GRCm39) missense probably benign 0.00
R6745:Chd1 UTSW 17 17,607,429 (GRCm39) missense probably benign 0.08
R7107:Chd1 UTSW 17 15,981,628 (GRCm39) missense probably damaging 0.98
R7230:Chd1 UTSW 17 15,927,199 (GRCm39) splice site probably null
R7317:Chd1 UTSW 17 15,962,536 (GRCm39) missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15,990,499 (GRCm39) missense probably damaging 0.99
R7421:Chd1 UTSW 17 15,969,660 (GRCm39) missense probably benign 0.03
R7704:Chd1 UTSW 17 15,987,737 (GRCm39) missense probably benign
R7763:Chd1 UTSW 17 15,953,303 (GRCm39) missense probably damaging 1.00
R8156:Chd1 UTSW 17 15,981,666 (GRCm39) missense probably benign
R8194:Chd1 UTSW 17 17,594,737 (GRCm39) start gained probably benign
R8261:Chd1 UTSW 17 17,607,804 (GRCm39) missense probably benign 0.02
R8338:Chd1 UTSW 17 15,990,242 (GRCm39) missense probably damaging 1.00
R8401:Chd1 UTSW 17 15,963,473 (GRCm39) missense probably damaging 1.00
R8411:Chd1 UTSW 17 15,982,711 (GRCm39) missense probably damaging 0.98
R9067:Chd1 UTSW 17 15,951,107 (GRCm39) missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15,962,551 (GRCm39) missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9212:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9666:Chd1 UTSW 17 15,955,976 (GRCm39) missense probably damaging 1.00
R9673:Chd1 UTSW 17 15,989,023 (GRCm39) missense probably benign 0.24
Z1176:Chd1 UTSW 17 15,988,995 (GRCm39) missense probably damaging 1.00
Z1176:Chd1 UTSW 17 15,986,609 (GRCm39) missense probably damaging 0.98
Z1177:Chd1 UTSW 17 15,968,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGCACTGTATTCATACGG -3'
(R):5'- TGCCATGATGAGGAAACAAATC -3'

Sequencing Primer
(F):5'- TGAACGAGGAGAATAATTTACTTGG -3'
(R):5'- GAGGAAACAAATCCCACTGTTTTAG -3'
Posted On 2016-06-06