Incidental Mutation 'R5078:Chd1'
ID 386987
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
MMRRC Submission 042667-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5078 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 15704967-15772610 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 15726354 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 121 (S121P)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
AlphaFold P40201
Predicted Effect possibly damaging
Transcript: ENSMUST00000024627
AA Change: S121P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: S121P

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173159
Predicted Effect possibly damaging
Transcript: ENSMUST00000173311
AA Change: S121P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: S121P

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy9 T C 16: 4,323,907 S345G probably benign Het
Adgrf2 A T 17: 42,710,986 F316I probably damaging Het
Ank2 A G 3: 126,942,353 probably benign Het
Auts2 T C 5: 132,258,947 K66E possibly damaging Het
Bicra T C 7: 15,975,457 D1144G probably damaging Het
Cabin1 A G 10: 75,721,478 S1109P probably damaging Het
Camkv T C 9: 107,945,373 V29A probably damaging Het
Ccdc178 A T 18: 22,067,628 probably null Het
Ccser1 G A 6: 61,311,366 R171H probably damaging Het
Cdk19 A G 10: 40,436,154 Y133C probably damaging Het
Cerkl T A 2: 79,393,008 D123V probably benign Het
Col4a2 T C 8: 11,443,936 V1459A probably benign Het
Dlg1 T A 16: 31,856,469 Y704* probably null Het
Dsg2 T C 18: 20,596,083 probably null Het
Egln3 T C 12: 54,181,667 R218G probably damaging Het
Gm11568 T C 11: 99,858,355 C129R unknown Het
Gm13991 T C 2: 116,527,874 noncoding transcript Het
Gmnc C A 16: 26,965,582 V58L probably benign Het
Gpx5 A G 13: 21,288,711 F151S probably damaging Het
Helz G A 11: 107,656,096 G1079R probably damaging Het
Ice1 T C 13: 70,604,850 E1039G probably benign Het
Kif18a T C 2: 109,295,142 probably benign Het
Klhl29 T C 12: 5,093,530 T500A possibly damaging Het
Lrfn5 A C 12: 61,843,874 K650Q possibly damaging Het
Lrp2 T C 2: 69,501,530 D1627G possibly damaging Het
Nxn T C 11: 76,261,607 K354E probably damaging Het
Olfr1165-ps T A 2: 88,101,535 I151L probably benign Het
Pcnx2 T C 8: 125,752,156 T2118A probably benign Het
Phldb2 A G 16: 45,777,742 F861L possibly damaging Het
Piezo2 A G 18: 63,024,536 Y2368H probably damaging Het
Pnp T A 14: 50,951,506 L252* probably null Het
Prom2 T C 2: 127,531,837 Q641R probably benign Het
Prpf31 T C 7: 3,634,703 S180P possibly damaging Het
Prss27 C A 17: 24,044,440 Y142* probably null Het
Ripk1 T G 13: 34,017,099 M265R probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Ropn1 T A 16: 34,666,791 D32E probably damaging Het
Rps23 T C 13: 90,923,703 F41L probably benign Het
Sec24d A G 3: 123,290,552 I127V probably benign Het
Selenot C T 3: 58,585,271 R60W probably damaging Het
Tll1 T C 8: 64,093,887 K342E probably damaging Het
Tlx1 A T 19: 45,156,021 N61Y probably damaging Het
Vmn2r117 T A 17: 23,460,148 I701F probably damaging Het
Zmynd12 A G 4: 119,444,850 K229E probably damaging Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
Holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R0883:Chd1 UTSW 17 15725431 missense probably benign
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 splice site probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7230:Chd1 UTSW 17 15706937 splice site probably null
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15770237 missense probably damaging 0.99
R7421:Chd1 UTSW 17 15749398 missense probably benign 0.03
R7704:Chd1 UTSW 17 15767475 missense probably benign
R7763:Chd1 UTSW 17 15733041 missense probably damaging 1.00
R8156:Chd1 UTSW 17 15761404 missense probably benign
R8194:Chd1 UTSW 17 17374475 start gained probably benign
R8261:Chd1 UTSW 17 17387542 missense probably benign 0.02
R8338:Chd1 UTSW 17 15769980 missense probably damaging 1.00
R8401:Chd1 UTSW 17 15743211 missense probably damaging 1.00
R8411:Chd1 UTSW 17 15762449 missense probably damaging 0.98
R9067:Chd1 UTSW 17 15730845 missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15742289 missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15730505 missense possibly damaging 0.70
R9212:Chd1 UTSW 17 15730505 missense possibly damaging 0.70
R9666:Chd1 UTSW 17 15735714 missense probably damaging 1.00
R9673:Chd1 UTSW 17 15768761 missense probably benign 0.24
Z1176:Chd1 UTSW 17 15766347 missense probably damaging 0.98
Z1176:Chd1 UTSW 17 15768733 missense probably damaging 1.00
Z1177:Chd1 UTSW 17 15747801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAGCACTGTATTCATACGG -3'
(R):5'- TGCCATGATGAGGAAACAAATC -3'

Sequencing Primer
(F):5'- TGAACGAGGAGAATAATTTACTTGG -3'
(R):5'- GAGGAAACAAATCCCACTGTTTTAG -3'
Posted On 2016-06-06