Incidental Mutation 'R5079:Sorcs2'
ID 387012
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 042668-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5079 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 36200796 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Threonine at position 584 (K584T)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect probably damaging
Transcript: ENSMUST00000037370
AA Change: K584T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: K584T

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Meta Mutation Damage Score 0.1853 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.6%
Validation Efficiency 90% (63/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik T C 5: 109,885,196 (GRCm39) S221G probably benign Het
Abca9 A T 11: 110,036,395 (GRCm39) F571L possibly damaging Het
Agbl4 T A 4: 111,423,826 (GRCm39) M284K possibly damaging Het
Ankrd16 A G 2: 11,783,710 (GRCm39) D104G probably damaging Het
Bpifc T C 10: 85,817,168 (GRCm39) D230G probably damaging Het
Casc3 C T 11: 98,701,252 (GRCm39) probably benign Het
Catsperd T C 17: 56,965,153 (GRCm39) probably null Het
Cpxm2 C T 7: 131,756,014 (GRCm39) probably null Het
Crisp1 A T 17: 40,619,867 (GRCm39) probably null Het
Crybg2 T C 4: 133,801,564 (GRCm39) I908T possibly damaging Het
Csn3 T C 5: 88,077,626 (GRCm39) V44A possibly damaging Het
Dipk1c A T 18: 84,748,702 (GRCm39) H100L probably benign Het
Dop1a T A 9: 86,369,474 (GRCm39) D102E probably damaging Het
Etfdh T C 3: 79,525,705 (GRCm39) Y111C probably damaging Het
Fat3 T C 9: 15,910,423 (GRCm39) S1860G probably benign Het
Gba2 G T 4: 43,568,640 (GRCm39) probably benign Het
Ggta1 A G 2: 35,312,249 (GRCm39) I43T possibly damaging Het
Glb1l2 T C 9: 26,682,405 (GRCm39) I149V probably benign Het
Gm5084 T A 13: 60,360,639 (GRCm39) noncoding transcript Het
Gm5591 G T 7: 38,221,560 (GRCm39) P170T probably benign Het
Gucy2d A T 7: 98,107,475 (GRCm39) probably null Het
Itpr3 T C 17: 27,317,397 (GRCm39) F851L probably damaging Het
Kat2b T A 17: 53,970,666 (GRCm39) I684N probably damaging Het
Klra17 C A 6: 129,849,159 (GRCm39) K138N possibly damaging Het
Lrrc4 T A 6: 28,830,769 (GRCm39) H282L possibly damaging Het
Lyst T C 13: 13,931,938 (GRCm39) I3522T probably benign Het
Man2c1 A G 9: 57,044,000 (GRCm39) T312A probably damaging Het
Mapkbp1 A G 2: 119,844,214 (GRCm39) R313G probably damaging Het
N4bp2 G A 5: 65,969,320 (GRCm39) G1361R probably damaging Het
Nbas A T 12: 13,424,712 (GRCm39) I984F probably damaging Het
Ncor1 T A 11: 62,236,063 (GRCm39) Q579L possibly damaging Het
Nme9 A G 9: 99,341,755 (GRCm39) Y35C probably damaging Het
Or5w13 C A 2: 87,523,552 (GRCm39) V225F probably damaging Het
Ormdl1 T C 1: 53,348,093 (GRCm39) V145A probably damaging Het
Paxbp1 C A 16: 90,822,034 (GRCm39) probably null Het
Pcnx1 C A 12: 82,025,863 (GRCm39) S1530* probably null Het
Pogk A G 1: 166,226,733 (GRCm39) W473R probably damaging Het
Pot1b A T 17: 55,976,801 (GRCm39) S374T probably benign Het
Rcn1 A G 2: 105,229,402 (GRCm39) F50S probably damaging Het
Rcvrn T A 11: 67,593,767 (GRCm39) I186N probably damaging Het
Rnd2 C T 11: 101,359,825 (GRCm39) L57F probably damaging Het
Ror1 T A 4: 100,298,619 (GRCm39) I664N probably damaging Het
Sall2 G T 14: 52,552,211 (GRCm39) A326E probably damaging Het
Sh2d6 G A 6: 72,496,833 (GRCm39) P66S probably benign Het
Slc6a20b T A 9: 123,427,563 (GRCm39) S449C probably damaging Het
Slc9a3 A T 13: 74,312,406 (GRCm39) N668Y probably damaging Het
Slco1a8 A C 6: 141,918,073 (GRCm39) I601R probably benign Het
Stam T C 2: 14,079,350 (GRCm39) M8T probably benign Het
Styk1 G A 6: 131,278,676 (GRCm39) P333S probably damaging Het
Sycp1 A G 3: 102,786,116 (GRCm39) C589R possibly damaging Het
Tas2r123 A G 6: 132,824,681 (GRCm39) I193V probably benign Het
Tnks1bp1 C A 2: 84,892,970 (GRCm39) Q304K probably damaging Het
Traf3ip2 T C 10: 39,502,473 (GRCm39) L207P probably damaging Het
Usp49 A G 17: 47,984,146 (GRCm39) S384G possibly damaging Het
Vezt T C 10: 93,856,486 (GRCm39) probably null Het
Vmn1r87 C A 7: 12,866,253 (GRCm39) M11I probably benign Het
Vmn2r39 A G 7: 9,026,489 (GRCm39) V504A probably benign Het
Wapl G A 14: 34,446,714 (GRCm39) A607T probably damaging Het
Zfp638 A G 6: 83,906,438 (GRCm39) N201S probably benign Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5727:Sorcs2 UTSW 5 36,188,630 (GRCm39) missense possibly damaging 0.52
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGGGCACTGTTCTAGTCTAC -3'
(R):5'- AATGGCCACTGTCTGCCAAAC -3'

Sequencing Primer
(F):5'- AGTCTACTCTGTGCCCACATG -3'
(R):5'- AACCCCTCGTGTGCTAAGTCAG -3'
Posted On 2016-06-06