Incidental Mutation 'R0426:Dnmbp'
ID 38703
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission 038628-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0426 (G1)
Quality Score 191
Status Validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 43852436 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212048] [ENSMUST00000212396] [ENSMUST00000212592]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026209
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157865
Predicted Effect probably benign
Transcript: ENSMUST00000212032
Predicted Effect probably benign
Transcript: ENSMUST00000212048
Predicted Effect probably benign
Transcript: ENSMUST00000212396
Predicted Effect probably benign
Transcript: ENSMUST00000212592
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 96% (86/90)
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830010M20Rik C T 5: 107,510,373 T1603I probably damaging Het
Abca8b G T 11: 109,955,027 probably benign Het
Acadl A T 1: 66,841,646 F320L probably damaging Het
Acsbg1 T C 9: 54,622,746 D222G probably benign Het
Anapc15 A G 7: 101,898,033 T39A probably benign Het
Ano3 A T 2: 110,661,174 V919E probably damaging Het
Arhgef12 T C 9: 42,970,990 probably null Het
Atad5 T A 11: 80,112,832 I1091N probably benign Het
Atf1 A T 15: 100,232,827 H26L possibly damaging Het
Atp10a T C 7: 58,784,734 M252T probably benign Het
Cd55 C T 1: 130,448,372 R347H probably benign Het
Cdc27 A C 11: 104,513,027 probably null Het
Cdh9 G A 15: 16,823,454 probably null Het
Cdk11b T C 4: 155,642,512 probably benign Het
Cep70 A G 9: 99,297,684 D567G probably benign Het
Cep78 A T 19: 15,970,970 Y382* probably null Het
Col9a2 T C 4: 121,044,660 probably benign Het
Cyp2d12 G A 15: 82,558,963 D409N probably benign Het
Ddx39 A G 8: 83,721,769 T217A probably benign Het
Dennd1b T A 1: 139,170,196 D733E probably benign Het
Dicer1 A G 12: 104,702,542 S1294P probably damaging Het
Dnah3 T C 7: 119,943,572 E3539G probably benign Het
Dysf T C 6: 84,149,757 L1332P probably damaging Het
F5 A G 1: 164,182,840 D380G probably damaging Het
Fam160a2 A C 7: 105,389,473 C186W probably damaging Het
Fam171a1 T C 2: 3,225,396 V522A probably benign Het
Galr2 C A 11: 116,281,691 A69D probably damaging Het
Grk2 T C 19: 4,290,600 probably null Het
Gtf3c1 A T 7: 125,663,016 Y1119* probably null Het
Hgd A T 16: 37,588,685 probably benign Het
Ildr2 G T 1: 166,308,899 V436L probably benign Het
Intu G A 3: 40,675,305 C355Y probably damaging Het
Irf2bpl G T 12: 86,883,096 P268T probably benign Het
Jarid2 T C 13: 44,840,882 probably null Het
Jup A T 11: 100,372,401 M716K probably benign Het
Kank1 G A 19: 25,411,473 V809I probably damaging Het
Kdm1b T A 13: 47,064,244 probably benign Het
Kdm3a C T 6: 71,600,755 C687Y probably damaging Het
Kdm5d T A Y: 942,437 probably benign Het
Kifap3 T A 1: 163,865,552 probably benign Het
Macf1 T A 4: 123,483,660 K1400* probably null Het
Majin A G 19: 6,212,117 probably benign Het
Mb21d1 G A 9: 78,435,738 probably benign Het
Mctp1 A G 13: 77,020,821 I846V probably benign Het
Mrgpra2b T A 7: 47,464,127 I286F possibly damaging Het
Neil3 T G 8: 53,609,396 probably benign Het
Nox3 G T 17: 3,695,563 N23K probably damaging Het
Nt5c3 T C 6: 56,883,812 K219E probably benign Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr213 A T 6: 116,540,485 N11Y probably damaging Het
Olfr389 T A 11: 73,776,437 M297L probably benign Het
Olfr524 A C 7: 140,202,116 F218C possibly damaging Het
Olfr548-ps1 T A 7: 102,542,686 I250N probably damaging Het
Olfr954 T C 9: 39,461,593 L54P probably damaging Het
Pacsin2 A G 15: 83,379,795 V347A possibly damaging Het
Pcdhb7 A T 18: 37,342,804 E331V probably damaging Het
Pcid2 A C 8: 13,081,262 probably null Het
Pcsk9 T C 4: 106,450,077 D323G possibly damaging Het
Pdhb T C 14: 8,169,801 E203G probably damaging Het
Phlpp2 A G 8: 109,928,463 Y630C probably benign Het
Pidd1 C T 7: 141,439,133 A812T probably damaging Het
Plau G A 14: 20,842,314 R389H probably benign Het
Plekhg6 G A 6: 125,364,629 probably null Het
Ppox T C 1: 171,277,749 Y321C probably damaging Het
Pxdn A G 12: 29,987,066 N281S possibly damaging Het
Pycrl A T 15: 75,918,388 M138K probably benign Het
Radil T C 5: 142,497,873 Y526C probably damaging Het
Ranbp3 C A 17: 56,707,169 D233E probably benign Het
Rhpn1 A G 15: 75,711,872 Q402R possibly damaging Het
Sec23b T A 2: 144,568,612 probably benign Het
Sel1l2 A T 2: 140,240,912 L602* probably null Het
Sema5b G A 16: 35,646,355 G209D probably damaging Het
Svep1 T C 4: 58,073,333 Y1992C possibly damaging Het
Syncrip T A 9: 88,456,259 probably benign Het
Synj1 G T 16: 90,967,354 A65E probably damaging Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tecrl T C 5: 83,354,763 probably benign Het
Tenm4 G T 7: 96,777,851 G698C probably damaging Het
Tmem209 G A 6: 30,491,182 L259F probably damaging Het
Tmem247 G A 17: 86,918,503 E124K possibly damaging Het
Tnks2 C A 19: 36,852,821 A218E probably damaging Het
Tppp T A 13: 74,021,311 F57I probably damaging Het
Trim36 A G 18: 46,172,525 W452R probably damaging Het
Vars2 A T 17: 35,664,584 V262E probably damaging Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Zfp516 G T 18: 82,955,772 A32S probably benign Het
Zfy2 G T Y: 2,107,348 L429I possibly damaging Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8902:Dnmbp UTSW 19 43901786 missense probably benign 0.00
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9628:Dnmbp UTSW 19 43870207 missense probably damaging 0.99
R9635:Dnmbp UTSW 19 43867535 missense probably benign 0.39
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGTCAAAGGCTCACCTCCGTTGTC -3'
(R):5'- GTAAGGGTGTTAGCTTGCCTCAGAG -3'

Sequencing Primer
(F):5'- ACCTCCGTTGTCCACGAG -3'
(R):5'- TGCCTCAGAGCCATTAAAACATTG -3'
Posted On 2013-05-23