Mutagenetix > Incidental Mutations

Incidental Mutation 'R5079:Slc9a3'

387046

Institutional Source

Beutler Lab

Gene Symbol

Slc9a3

Ensembl Gene

ENSMUSG00000036123

Gene Name

solute carrier family 9 (sodium/hydrogen exchanger), member 3

Synonyms

9030624O13Rik, NHE-3, NHE3

MMRRC Submission

042668-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74121457-74169442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 74164287 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 668 (N668Y)

Ref Sequence

ENSEMBL: ENSMUSP00000153255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036208] [ENSMUST00000221703] [ENSMUST00000225423]

AlphaFold

G3X939

Predicted Effect

probably damaging
Transcript: ENSMUST00000036208
AA Change: N668Y

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038142
Gene: ENSMUSG00000036123
AA Change: N668Y

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Na_H_Exchanger	53	457	3.6e-87	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000221703
AA Change: N668Y

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225423
AA Change: N668Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Meta Mutation Damage Score

0.0675

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.6%

Validation Efficiency

90% (63/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial brush border Na/H exchanger that uses an inward sodium ion gradient to expel acids from the cell. Defects in this gene are a cause of congenital secretory sodium diarrhea. Pseudogenes of this gene exist on chromosomes 10 and 22. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice have diarrhea associated with defects of renal and intestinal absorption. Males are infertile. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,737,330	S221G	probably benign	Het
Abca9	A	T	11: 110,145,569	F571L	possibly damaging	Het
Agbl4	T	A	4: 111,566,629	M284K	possibly damaging	Het
Ankrd16	A	G	2: 11,778,899	D104G	probably damaging	Het
Bpifc	T	C	10: 85,981,304	D230G	probably damaging	Het
Casc3	C	T	11: 98,810,426		probably benign	Het
Catsperd	T	C	17: 56,658,153		probably null	Het
Cpxm2	C	T	7: 132,154,285		probably null	Het
Crisp1	A	T	17: 40,308,976		probably null	Het
Crybg2	T	C	4: 134,074,253	I908T	possibly damaging	Het
Csn3	T	C	5: 87,929,767	V44A	possibly damaging	Het
Dopey1	T	A	9: 86,487,421	D102E	probably damaging	Het
Etfdh	T	C	3: 79,618,398	Y111C	probably damaging	Het
Fam69c	A	T	18: 84,730,577	H100L	probably benign	Het
Fat3	T	C	9: 15,999,127	S1860G	probably benign	Het
Gba2	G	T	4: 43,568,640		probably benign	Het
Ggta1	A	G	2: 35,422,237	I43T	possibly damaging	Het
Glb1l2	T	C	9: 26,771,109	I149V	probably benign	Het
Gm5084	T	A	13: 60,212,825		noncoding transcript	Het
Gm5591	G	T	7: 38,522,136	P170T	probably benign	Het
Gm6614	A	C	6: 141,972,347	I601R	probably benign	Het
Gucy2d	A	T	7: 98,458,268		probably null	Het
Itpr3	T	C	17: 27,098,423	F851L	probably damaging	Het
Kat2b	T	A	17: 53,663,638	I684N	probably damaging	Het
Klra17	C	A	6: 129,872,196	K138N	possibly damaging	Het
Lrrc4	T	A	6: 28,830,770	H282L	possibly damaging	Het
Lyst	T	C	13: 13,757,353	I3522T	probably benign	Het
Man2c1	A	G	9: 57,136,716	T312A	probably damaging	Het
Mapkbp1	A	G	2: 120,013,733	R313G	probably damaging	Het
N4bp2	G	A	5: 65,811,977	G1361R	probably damaging	Het
Nbas	A	T	12: 13,374,711	I984F	probably damaging	Het
Ncor1	T	A	11: 62,345,237	Q579L	possibly damaging	Het
Nme9	A	G	9: 99,459,702	Y35C	probably damaging	Het
Olfr1136	C	A	2: 87,693,208	V225F	probably damaging	Het
Ormdl1	T	C	1: 53,308,934	V145A	probably damaging	Het
Paxbp1	C	A	16: 91,025,146		probably null	Het
Pcnx	C	A	12: 81,979,089	S1530*	probably null	Het
Pogk	A	G	1: 166,399,164	W473R	probably damaging	Het
Pot1b	A	T	17: 55,669,801	S374T	probably benign	Het
Rcn1	A	G	2: 105,399,057	F50S	probably damaging	Het
Rcvrn	T	A	11: 67,702,941	I186N	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ror1	T	A	4: 100,441,422	I664N	probably damaging	Het
Sall2	G	T	14: 52,314,754	A326E	probably damaging	Het
Sh2d6	G	A	6: 72,519,850	P66S	probably benign	Het
Slc6a20b	T	A	9: 123,598,498	S449C	probably damaging	Het
Sorcs2	T	G	5: 36,043,452	K584T	probably damaging	Het
Stam	T	C	2: 14,074,539	M8T	probably benign	Het
Styk1	G	A	6: 131,301,713	P333S	probably damaging	Het
Sycp1	A	G	3: 102,878,800	C589R	possibly damaging	Het
Tas2r123	A	G	6: 132,847,718	I193V	probably benign	Het
Tnks1bp1	C	A	2: 85,062,626	Q304K	probably damaging	Het
Traf3ip2	T	C	10: 39,626,477	L207P	probably damaging	Het
Usp49	A	G	17: 47,673,221	S384G	possibly damaging	Het
Vezt	T	C	10: 94,020,624		probably null	Het
Vmn1r87	C	A	7: 13,132,326	M11I	probably benign	Het
Vmn2r39	A	G	7: 9,023,490	V504A	probably benign	Het
Wapl	G	A	14: 34,724,757	A607T	probably damaging	Het
Zfp638	A	G	6: 83,929,456	N201S	probably benign	Het

Other mutations in Slc9a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Slc9a3	APN	13	74160302	missense	probably benign	0.19
IGL01299:Slc9a3	APN	13	74160263	missense	probably benign	0.33
IGL01390:Slc9a3	APN	13	74150761	missense	probably benign	0.01
IGL01814:Slc9a3	APN	13	74165972	missense	probably damaging	0.96
IGL02020:Slc9a3	APN	13	74158848	missense	probably damaging	0.99
IGL02072:Slc9a3	APN	13	74165859	missense	probably benign	0.00
IGL02186:Slc9a3	APN	13	74163114	missense	possibly damaging	0.94
IGL02878:Slc9a3	APN	13	74165357	nonsense	probably null
IGL03056:Slc9a3	APN	13	74150819	missense	probably damaging	1.00
R0090:Slc9a3	UTSW	13	74158728	missense	probably damaging	0.99
R0280:Slc9a3	UTSW	13	74159424	missense	probably damaging	1.00
R0359:Slc9a3	UTSW	13	74157607	missense	probably damaging	1.00
R0388:Slc9a3	UTSW	13	74121536	missense	unknown
R0396:Slc9a3	UTSW	13	74157784	critical splice donor site	probably null
R0893:Slc9a3	UTSW	13	74159246	missense	probably damaging	1.00
R1169:Slc9a3	UTSW	13	74150743	missense	probably damaging	0.98
R1640:Slc9a3	UTSW	13	74158818	missense	probably damaging	1.00
R1769:Slc9a3	UTSW	13	74163071	missense	probably benign	0.00
R1850:Slc9a3	UTSW	13	74161770	missense	probably benign	0.34
R1937:Slc9a3	UTSW	13	74166056	splice site	probably null
R2048:Slc9a3	UTSW	13	74163741	missense	probably damaging	1.00
R2146:Slc9a3	UTSW	13	74121603	missense	probably benign	0.00
R2495:Slc9a3	UTSW	13	74158703	missense	probably damaging	0.99
R2883:Slc9a3	UTSW	13	74158760	missense	probably damaging	1.00
R2938:Slc9a3	UTSW	13	74121669	missense	possibly damaging	0.62
R4538:Slc9a3	UTSW	13	74161732	missense	possibly damaging	0.56
R4580:Slc9a3	UTSW	13	74158886	nonsense	probably null
R4581:Slc9a3	UTSW	13	74164165	missense	probably damaging	0.99
R4841:Slc9a3	UTSW	13	74165837	missense	probably damaging	1.00
R4928:Slc9a3	UTSW	13	74157719	missense	probably damaging	1.00
R4965:Slc9a3	UTSW	13	74164293	missense	possibly damaging	0.62
R5329:Slc9a3	UTSW	13	74150960	missense	possibly damaging	0.94
R5663:Slc9a3	UTSW	13	74163712	missense	probably damaging	0.98
R5876:Slc9a3	UTSW	13	74161723	missense	probably damaging	1.00
R5919:Slc9a3	UTSW	13	74158740	missense	probably damaging	0.98
R6060:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R6562:Slc9a3	UTSW	13	74155161	missense	probably damaging	1.00
R6645:Slc9a3	UTSW	13	74164172	missense	probably damaging	0.99
R7145:Slc9a3	UTSW	13	74150678	missense	probably damaging	0.99
R7422:Slc9a3	UTSW	13	74150885	missense	probably damaging	1.00
R7565:Slc9a3	UTSW	13	74157694	missense	probably damaging	1.00
R7679:Slc9a3	UTSW	13	74160276	missense	possibly damaging	0.88
R8032:Slc9a3	UTSW	13	74157644	missense	probably damaging	1.00
R8080:Slc9a3	UTSW	13	74166027	missense	probably benign	0.30
R8158:Slc9a3	UTSW	13	74155122	missense	probably damaging	1.00
R8159:Slc9a3	UTSW	13	74164288	missense	probably benign	0.01
R8837:Slc9a3	UTSW	13	74157704	missense	probably damaging	1.00
R8939:Slc9a3	UTSW	13	74163776	missense	possibly damaging	0.93
R9111:Slc9a3	UTSW	13	74150801	missense	probably damaging	1.00
Z1176:Slc9a3	UTSW	13	74165856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGCCTTCTTCTCAGACAAGGG -3'
(R):5'- GCAGGAATTTGGTCTCTGCTC -3'

Sequencing Primer
(F):5'- ATGAGCTGGAGATCCTGTGACC -3'
(R):5'- GTCTCTGCTCTGGTGAAAGTC -3'

Posted On

2016-06-06