Mutagenetix > Incidental Mutations

Incidental Mutation 'R5079:Wapl'

387047

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

042668-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34724757 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 607 (A607T)

Ref Sequence

ENSEMBL: ENSMUSP00000130547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048263
AA Change: A607T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: A607T

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090027
AA Change: A601T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: A601T

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111895

Predicted Effect

probably benign
Transcript: ENSMUST00000151285

SMART Domains

Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	281	1.1e-78	PFAM
coiled coil region	329	351	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169910
AA Change: A607T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: A607T

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000172658

Meta Mutation Damage Score

0.1045

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.1%
20x: 91.6%

Validation Efficiency

90% (63/70)

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	C	5: 109,737,330	S221G	probably benign	Het
Abca9	A	T	11: 110,145,569	F571L	possibly damaging	Het
Agbl4	T	A	4: 111,566,629	M284K	possibly damaging	Het
Ankrd16	A	G	2: 11,778,899	D104G	probably damaging	Het
Bpifc	T	C	10: 85,981,304	D230G	probably damaging	Het
Casc3	C	T	11: 98,810,426		probably benign	Het
Catsperd	T	C	17: 56,658,153		probably null	Het
Cpxm2	C	T	7: 132,154,285		probably null	Het
Crisp1	A	T	17: 40,308,976		probably null	Het
Crybg2	T	C	4: 134,074,253	I908T	possibly damaging	Het
Csn3	T	C	5: 87,929,767	V44A	possibly damaging	Het
Dopey1	T	A	9: 86,487,421	D102E	probably damaging	Het
Etfdh	T	C	3: 79,618,398	Y111C	probably damaging	Het
Fam69c	A	T	18: 84,730,577	H100L	probably benign	Het
Fat3	T	C	9: 15,999,127	S1860G	probably benign	Het
Gba2	G	T	4: 43,568,640		probably benign	Het
Ggta1	A	G	2: 35,422,237	I43T	possibly damaging	Het
Glb1l2	T	C	9: 26,771,109	I149V	probably benign	Het
Gm5084	T	A	13: 60,212,825		noncoding transcript	Het
Gm5591	G	T	7: 38,522,136	P170T	probably benign	Het
Gm6614	A	C	6: 141,972,347	I601R	probably benign	Het
Gucy2d	A	T	7: 98,458,268		probably null	Het
Itpr3	T	C	17: 27,098,423	F851L	probably damaging	Het
Kat2b	T	A	17: 53,663,638	I684N	probably damaging	Het
Klra17	C	A	6: 129,872,196	K138N	possibly damaging	Het
Lrrc4	T	A	6: 28,830,770	H282L	possibly damaging	Het
Lyst	T	C	13: 13,757,353	I3522T	probably benign	Het
Man2c1	A	G	9: 57,136,716	T312A	probably damaging	Het
Mapkbp1	A	G	2: 120,013,733	R313G	probably damaging	Het
N4bp2	G	A	5: 65,811,977	G1361R	probably damaging	Het
Nbas	A	T	12: 13,374,711	I984F	probably damaging	Het
Ncor1	T	A	11: 62,345,237	Q579L	possibly damaging	Het
Nme9	A	G	9: 99,459,702	Y35C	probably damaging	Het
Olfr1136	C	A	2: 87,693,208	V225F	probably damaging	Het
Ormdl1	T	C	1: 53,308,934	V145A	probably damaging	Het
Paxbp1	C	A	16: 91,025,146		probably null	Het
Pcnx	C	A	12: 81,979,089	S1530*	probably null	Het
Pogk	A	G	1: 166,399,164	W473R	probably damaging	Het
Pot1b	A	T	17: 55,669,801	S374T	probably benign	Het
Rcn1	A	G	2: 105,399,057	F50S	probably damaging	Het
Rcvrn	T	A	11: 67,702,941	I186N	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Ror1	T	A	4: 100,441,422	I664N	probably damaging	Het
Sall2	G	T	14: 52,314,754	A326E	probably damaging	Het
Sh2d6	G	A	6: 72,519,850	P66S	probably benign	Het
Slc6a20b	T	A	9: 123,598,498	S449C	probably damaging	Het
Slc9a3	A	T	13: 74,164,287	N668Y	probably damaging	Het
Sorcs2	T	G	5: 36,043,452	K584T	probably damaging	Het
Stam	T	C	2: 14,074,539	M8T	probably benign	Het
Styk1	G	A	6: 131,301,713	P333S	probably damaging	Het
Sycp1	A	G	3: 102,878,800	C589R	possibly damaging	Het
Tas2r123	A	G	6: 132,847,718	I193V	probably benign	Het
Tnks1bp1	C	A	2: 85,062,626	Q304K	probably damaging	Het
Traf3ip2	T	C	10: 39,626,477	L207P	probably damaging	Het
Usp49	A	G	17: 47,673,221	S384G	possibly damaging	Het
Vezt	T	C	10: 94,020,624		probably null	Het
Vmn1r87	C	A	7: 13,132,326	M11I	probably benign	Het
Vmn2r39	A	G	7: 9,023,490	V504A	probably benign	Het
Zfp638	A	G	6: 83,929,456	N201S	probably benign	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- TAGGAACTTTCAGCAGCCTCC -3'
(R):5'- GTTCAAAATGTGGCTAGCAATGTAGTG -3'

Sequencing Primer
(F):5'- AACTTTCAGCAGCCTCCCTCTTC -3'
(R):5'- TGGCTAGCAATGTAGTGATATTTG -3'

Posted On

2016-06-06