Incidental Mutation 'R5080:Wasf3'
ID387077
Institutional Source Beutler Lab
Gene Symbol Wasf3
Ensembl Gene ENSMUSG00000029636
Gene NameWAS protein family, member 3
SynonymsWave3
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5080 (G1)
Quality Score178
Status Validated
Chromosome5
Chromosomal Location146384985-146473615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 146461097 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 225 (H225Y)
Ref Sequence ENSEMBL: ENSMUSP00000016143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016143]
Predicted Effect probably benign
Transcript: ENSMUST00000016143
AA Change: H225Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016143
Gene: ENSMUSG00000029636
AA Change: H225Y

DomainStartEndE-ValueType
PDB:3P8C|D 1 171 1e-86 PDB
low complexity region 172 184 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 395 422 N/A INTRINSIC
WH2 439 456 4.97e-5 SMART
low complexity region 484 501 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Wiskott-Aldrich syndrome protein family. The gene product is a protein that forms a multiprotein complex that links receptor kinases and actin. Binding to actin occurs through a C-terminal verprolin homology domain in all family members. The multiprotein complex serves to tranduce signals that involve changes in cell shape, motility or function. A pseudogene of this gene have been defined on chromosome 6. Alternative splicing results in multiple transcript variants [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal platelet physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Wasf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Wasf3 APN 5 146455651 missense probably damaging 1.00
IGL01992:Wasf3 APN 5 146455591 missense probably damaging 1.00
IGL02866:Wasf3 APN 5 146468321 missense probably benign 0.28
FR4737:Wasf3 UTSW 5 146470250 missense probably damaging 0.99
R0622:Wasf3 UTSW 5 146466792 splice site probably null
R1083:Wasf3 UTSW 5 146435372 missense probably damaging 1.00
R1214:Wasf3 UTSW 5 146470288 missense probably damaging 1.00
R1259:Wasf3 UTSW 5 146451976 missense probably damaging 1.00
R1355:Wasf3 UTSW 5 146470208 splice site probably benign
R1370:Wasf3 UTSW 5 146470208 splice site probably benign
R1727:Wasf3 UTSW 5 146466959 missense probably benign
R4837:Wasf3 UTSW 5 146460978 missense probably benign 0.16
R6046:Wasf3 UTSW 5 146470356 missense unknown
R6386:Wasf3 UTSW 5 146453417 missense possibly damaging 0.77
R7181:Wasf3 UTSW 5 146466805 missense probably benign
R7229:Wasf3 UTSW 5 146455653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAACTGCATCTAACCTGCTG -3'
(R):5'- AAAGGCTTGCAAAGTGACCC -3'

Sequencing Primer
(F):5'- ACTGCATCTAACCTGCTGTTTTC -3'
(R):5'- GGCTTGCAAAGTGACCCACATTC -3'
Posted On2016-06-06