Incidental Mutation 'R5080:Strip2'
ID387078
Institutional Source Beutler Lab
Gene Symbol Strip2
Ensembl Gene ENSMUSG00000039629
Gene Namestriatin interacting protein 2
SynonymsFam40b, D330017J20Rik
MMRRC Submission 042669-MU
Accession Numbers

Genbank: NM_177204.3, NM_001037740.1; Ensembl: ENSMUST00000046028

Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location29917012-29959681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29945593 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 660 (L660H)
Ref Sequence ENSEMBL: ENSMUSP00000110879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046028] [ENSMUST00000115224] [ENSMUST00000151738]
Predicted Effect probably benign
Transcript: ENSMUST00000046028
SMART Domains Protein: ENSMUSP00000036477
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 822 4.98e-199 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115224
AA Change: L660H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110879
Gene: ENSMUSG00000039629
AA Change: L660H

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 662 4.85e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137068
Predicted Effect probably benign
Transcript: ENSMUST00000151738
SMART Domains Protein: ENSMUSP00000119506
Gene: ENSMUSG00000039629

DomainStartEndE-ValueType
low complexity region 2 40 N/A INTRINSIC
N1221 57 364 1.68e-132 SMART
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 419 N/A INTRINSIC
DUF3402 466 794 1.72e-161 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr10 G T 11: 49,318,087 M180I probably benign Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Strip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Strip2 APN 6 29931214 missense probably benign 0.04
IGL01357:Strip2 APN 6 29939167 splice site probably benign
IGL01636:Strip2 APN 6 29931193 missense probably benign 0.06
IGL01959:Strip2 APN 6 29928554 missense probably damaging 0.99
IGL01961:Strip2 APN 6 29928427 splice site probably benign
IGL02089:Strip2 APN 6 29917180 unclassified probably benign
1mM(1):Strip2 UTSW 6 29955631 missense probably damaging 1.00
R0079:Strip2 UTSW 6 29920533 critical splice donor site probably null
R0331:Strip2 UTSW 6 29926560 missense probably benign 0.44
R0367:Strip2 UTSW 6 29937651 missense possibly damaging 0.90
R0592:Strip2 UTSW 6 29931210 missense probably benign 0.28
R1087:Strip2 UTSW 6 29927634 missense probably damaging 0.99
R1390:Strip2 UTSW 6 29929829 missense probably damaging 1.00
R1758:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2213:Strip2 UTSW 6 29931148 missense probably damaging 0.99
R2437:Strip2 UTSW 6 29941941 critical splice donor site probably null
R2900:Strip2 UTSW 6 29939035 critical splice acceptor site probably null
R3892:Strip2 UTSW 6 29917075 unclassified probably benign
R4010:Strip2 UTSW 6 29955585 missense possibly damaging 0.66
R4435:Strip2 UTSW 6 29925050 missense probably benign 0.06
R4807:Strip2 UTSW 6 29925093 nonsense probably null
R5015:Strip2 UTSW 6 29931266 missense probably benign 0.03
R5484:Strip2 UTSW 6 29917155 unclassified probably benign
R5502:Strip2 UTSW 6 29927624 missense probably benign 0.23
R5899:Strip2 UTSW 6 29956958 utr 3 prime probably benign
R6004:Strip2 UTSW 6 29926571 missense probably damaging 0.98
R6479:Strip2 UTSW 6 29944497 splice site probably null
R6835:Strip2 UTSW 6 29941917 missense probably damaging 1.00
R7068:Strip2 UTSW 6 29932208 missense probably benign 0.03
R7073:Strip2 UTSW 6 29941912 missense possibly damaging 0.95
R7088:Strip2 UTSW 6 29920533 critical splice donor site probably null
R7231:Strip2 UTSW 6 29944487 missense probably damaging 0.96
R7399:Strip2 UTSW 6 29927613 missense possibly damaging 0.94
R7813:Strip2 UTSW 6 29923913 critical splice acceptor site probably null
R7827:Strip2 UTSW 6 29923929 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AAAAGTCGTGGCTAGCTCATGC -3'
(R):5'- AATCTCAGAGACATCCTTTCCTAC -3'

Sequencing Primer
(F):5'- GCTCATGCTTTGCTACTGAGC -3'
(R):5'- GCTGTAAGCTGCCATGAAGC -3'
Posted On2016-06-06