Mutagenetix > Incidental Mutations

Incidental Mutation 'R5080:Ces1d'

387081

Institutional Source

Beutler Lab

Gene Symbol

Ces1d

Ensembl Gene

ENSMUSG00000056973

Gene Name

carboxylesterase 1D

Synonyms

TGH, Ces3

MMRRC Submission

042669-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5080 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93166068-93197838 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93181547 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 306 (D306G)

Ref Sequence

ENSEMBL: ENSMUSP00000034172 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034172]

Predicted Effect

probably benign
Transcript: ENSMUST00000034172
AA Change: D306G

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000034172
Gene: ENSMUSG00000056973
AA Change: D306G

Domain	Start	End	E-Value	Type
Pfam:COesterase	1	545	4.9e-169	PFAM
Pfam:Abhydrolase_3	136	256	8.1e-11	PFAM

Meta Mutation Damage Score

0.2963

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 92.5%

Validation Efficiency

96% (54/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased blood lipids, improved glucose tolerance, and increased energy expenditure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acod1	G	A	14: 103,049,308	G16S	possibly damaging	Het
Adcy4	A	T	14: 55,772,375	M740K	probably damaging	Het
Atp1a2	T	C	1: 172,284,445		probably benign	Het
Atrn	T	A	2: 130,970,124	I663N	possibly damaging	Het
Cacna2d1	T	C	5: 16,362,396		probably null	Het
Carf	C	A	1: 60,150,613	Q631K	probably damaging	Het
Corin	T	A	5: 72,353,851		probably benign	Het
Csf1r	T	C	18: 61,124,301	F575L	probably damaging	Het
Dcaf6	T	C	1: 165,420,121	D181G	probably damaging	Het
Dnah11	C	T	12: 118,198,830	M1I	probably null	Het
Dnah7b	C	T	1: 46,182,380	R1215*	probably null	Het
Dpp3	T	A	19: 4,915,080	D464V	probably benign	Het
Drosha	C	A	15: 12,842,143	A344D	probably benign	Het
Fam160b1	A	T	19: 57,373,281	K134I	probably damaging	Het
Fat3	G	T	9: 15,999,338	S1789R	probably benign	Het
Frg2f1	T	C	4: 119,531,033	T90A	possibly damaging	Het
Frrs1	T	C	3: 116,902,936	I544T	probably benign	Het
Gm10020	A	G	15: 52,478,050		noncoding transcript	Het
Gm20939	T	C	17: 94,876,991	C356R	probably damaging	Het
Ifi206	T	A	1: 173,473,848	I755F	possibly damaging	Het
Kntc1	T	A	5: 123,762,586	V249E	possibly damaging	Het
Lama5	A	T	2: 180,207,200	L230*	probably null	Het
Lce1e	C	T	3: 92,707,830	C70Y	unknown	Het
Ltbp2	T	C	12: 84,803,864	N892S	probably damaging	Het
Mfsd4b5	T	A	10: 39,970,574	M337L	probably damaging	Het
Noxo1	T	A	17: 24,699,357	C164S	probably damaging	Het
Olfr10	G	T	11: 49,318,087	M180I	probably benign	Het
Olfr1052	G	A	2: 86,297,914	V33M	probably benign	Het
Osbpl6	T	C	2: 76,524,085	S15P	probably benign	Het
Pcdh17	A	G	14: 84,533,310	Y1076C	probably benign	Het
Pik3c2a	T	A	7: 116,348,274	H1391L	probably damaging	Het
Plcg2	A	G	8: 117,590,003	Y573C	probably benign	Het
Prpf3	T	A	3: 95,833,797	H600L	probably benign	Het
Rilpl2	T	C	5: 124,469,813	T115A	probably benign	Het
Serpini1	T	C	3: 75,616,660	S192P	probably damaging	Het
Sp110	G	T	1: 85,596,055	Y18*	probably null	Het
Stard6	A	T	18: 70,496,222	I126F	probably damaging	Het
Strip2	T	A	6: 29,945,593	L660H	probably damaging	Het
Tmed3	G	A	9: 89,699,772	R213*	probably null	Het
Tns1	G	T	1: 73,952,940	P860T	probably damaging	Het
Togaram1	T	C	12: 64,983,403	S994P	probably benign	Het
Tomm34	G	A	2: 164,070,896		probably benign	Het
Trank1	G	A	9: 111,389,221	E1890K	probably damaging	Het
Wasf3	C	T	5: 146,461,097	H225Y	probably benign	Het
Wdr37	A	T	13: 8,847,674		probably null	Het
Zbtb7c	A	C	18: 76,137,342	D167A	probably benign	Het
Zkscan4	A	G	13: 21,481,328	T158A	probably benign	Het

Other mutations in Ces1d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Ces1d	APN	8	93195089	splice site	probably benign
IGL01707:Ces1d	APN	8	93189550	missense	possibly damaging	0.57
IGL01753:Ces1d	APN	8	93192810	missense	probably damaging	1.00
IGL01918:Ces1d	APN	8	93178075	missense	probably benign	0.00
IGL02730:Ces1d	APN	8	93186016	missense	probably benign
IGL02819:Ces1d	APN	8	93169718	splice site	probably null
IGL02824:Ces1d	APN	8	93169718	splice site	probably null
IGL02825:Ces1d	APN	8	93169718	splice site	probably null
IGL02858:Ces1d	APN	8	93169718	splice site	probably null
IGL02877:Ces1d	APN	8	93169718	splice site	probably null
IGL02946:Ces1d	APN	8	93169718	splice site	probably null
IGL02990:Ces1d	APN	8	93169718	splice site	probably null
IGL03024:Ces1d	APN	8	93169718	splice site	probably null
IGL03080:Ces1d	APN	8	93169718	splice site	probably null
IGL03081:Ces1d	APN	8	93169718	splice site	probably null
IGL03082:Ces1d	APN	8	93169718	splice site	probably null
IGL03096:Ces1d	APN	8	93178042	missense	probably benign	0.01
IGL03165:Ces1d	APN	8	93189519	missense	probably benign	0.02
IGL03233:Ces1d	APN	8	93195079	missense	probably benign
IGL03263:Ces1d	APN	8	93169718	splice site	probably null
IGL03310:Ces1d	APN	8	93175188	splice site	probably benign
IGL03338:Ces1d	APN	8	93169718	splice site	probably null
IGL03357:Ces1d	APN	8	93169718	splice site	probably null
R0125:Ces1d	UTSW	8	93175182	splice site	probably benign
R0393:Ces1d	UTSW	8	93192772	missense	probably damaging	1.00
R0483:Ces1d	UTSW	8	93197679	missense	probably benign
R0746:Ces1d	UTSW	8	93189468	missense	probably damaging	1.00
R1470:Ces1d	UTSW	8	93195021	missense	possibly damaging	0.50
R1470:Ces1d	UTSW	8	93195021	missense	possibly damaging	0.50
R1607:Ces1d	UTSW	8	93186118	missense	probably benign	0.08
R1879:Ces1d	UTSW	8	93189498	missense	probably benign	0.35
R2881:Ces1d	UTSW	8	93195031	missense	probably damaging	1.00
R3870:Ces1d	UTSW	8	93175086	missense	probably benign	0.15
R4004:Ces1d	UTSW	8	93178092	missense	probably benign	0.03
R4573:Ces1d	UTSW	8	93181534	missense	probably benign	0.00
R4647:Ces1d	UTSW	8	93166410	missense	probably damaging	1.00
R4985:Ces1d	UTSW	8	93175144	missense	possibly damaging	0.61
R5209:Ces1d	UTSW	8	93175188	splice site	probably benign
R5351:Ces1d	UTSW	8	93178078	missense	probably damaging	1.00
R5433:Ces1d	UTSW	8	93186036	missense	probably benign	0.02
R5614:Ces1d	UTSW	8	93176204	missense	probably benign	0.00
R5722:Ces1d	UTSW	8	93178128	missense	probably benign	0.01
R6257:Ces1d	UTSW	8	93166397	missense	probably benign	0.03
R7238:Ces1d	UTSW	8	93178135	missense	probably benign	0.01
R7410:Ces1d	UTSW	8	93192805	missense	probably damaging	1.00
R7489:Ces1d	UTSW	8	93178131	missense	probably damaging	1.00
R7563:Ces1d	UTSW	8	93178039	missense	probably benign	0.25
R7827:Ces1d	UTSW	8	93197666	critical splice donor site	probably null
RF014:Ces1d	UTSW	8	93176165	critical splice donor site	probably null
Z1088:Ces1d	UTSW	8	93175108	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGTGTTATGAGTGCAGGCAAC -3'
(R):5'- AATCCTGACTCTGGGTCCTATG -3'

Sequencing Primer
(F):5'- GGCAACTTCCCCTCTCAAAGG -3'
(R):5'- GTCCTATGACCTTTCCCCCTTG -3'

Posted On

2016-06-06