Incidental Mutation 'R5080:Olfr10'
ID387088
Institutional Source Beutler Lab
Gene Symbol Olfr10
Ensembl Gene ENSMUSG00000100923
Gene Nameolfactory receptor 10
SynonymsMOR256-55, L45, GA_x6K02T2QP88-6117098-6116163
MMRRC Submission 042669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5080 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49304741-49320021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 49318087 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 180 (M180I)
Ref Sequence ENSEMBL: ENSMUSP00000149724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187570] [ENSMUST00000215671] [ENSMUST00000217290]
Predicted Effect probably benign
Transcript: ENSMUST00000187570
AA Change: M180I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000139744
Gene: ENSMUSG00000100923
AA Change: M180I

DomainStartEndE-ValueType
low complexity region 23 34 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 35 222 4.7e-7 PFAM
Pfam:7tm_1 41 289 1.3e-33 PFAM
Pfam:7tm_4 139 282 4.6e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215671
Predicted Effect probably benign
Transcript: ENSMUST00000217290
AA Change: M180I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.2003 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.5%
Validation Efficiency 96% (54/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acod1 G A 14: 103,049,308 G16S possibly damaging Het
Adcy4 A T 14: 55,772,375 M740K probably damaging Het
Atp1a2 T C 1: 172,284,445 probably benign Het
Atrn T A 2: 130,970,124 I663N possibly damaging Het
Cacna2d1 T C 5: 16,362,396 probably null Het
Carf C A 1: 60,150,613 Q631K probably damaging Het
Ces1d T C 8: 93,181,547 D306G probably benign Het
Corin T A 5: 72,353,851 probably benign Het
Csf1r T C 18: 61,124,301 F575L probably damaging Het
Dcaf6 T C 1: 165,420,121 D181G probably damaging Het
Dnah11 C T 12: 118,198,830 M1I probably null Het
Dnah7b C T 1: 46,182,380 R1215* probably null Het
Dpp3 T A 19: 4,915,080 D464V probably benign Het
Drosha C A 15: 12,842,143 A344D probably benign Het
Fam160b1 A T 19: 57,373,281 K134I probably damaging Het
Fat3 G T 9: 15,999,338 S1789R probably benign Het
Frg2f1 T C 4: 119,531,033 T90A possibly damaging Het
Frrs1 T C 3: 116,902,936 I544T probably benign Het
Gm10020 A G 15: 52,478,050 noncoding transcript Het
Gm20939 T C 17: 94,876,991 C356R probably damaging Het
Ifi206 T A 1: 173,473,848 I755F possibly damaging Het
Kntc1 T A 5: 123,762,586 V249E possibly damaging Het
Lama5 A T 2: 180,207,200 L230* probably null Het
Lce1e C T 3: 92,707,830 C70Y unknown Het
Ltbp2 T C 12: 84,803,864 N892S probably damaging Het
Mfsd4b5 T A 10: 39,970,574 M337L probably damaging Het
Noxo1 T A 17: 24,699,357 C164S probably damaging Het
Olfr1052 G A 2: 86,297,914 V33M probably benign Het
Osbpl6 T C 2: 76,524,085 S15P probably benign Het
Pcdh17 A G 14: 84,533,310 Y1076C probably benign Het
Pik3c2a T A 7: 116,348,274 H1391L probably damaging Het
Plcg2 A G 8: 117,590,003 Y573C probably benign Het
Prpf3 T A 3: 95,833,797 H600L probably benign Het
Rilpl2 T C 5: 124,469,813 T115A probably benign Het
Serpini1 T C 3: 75,616,660 S192P probably damaging Het
Sp110 G T 1: 85,596,055 Y18* probably null Het
Stard6 A T 18: 70,496,222 I126F probably damaging Het
Strip2 T A 6: 29,945,593 L660H probably damaging Het
Tmed3 G A 9: 89,699,772 R213* probably null Het
Tns1 G T 1: 73,952,940 P860T probably damaging Het
Togaram1 T C 12: 64,983,403 S994P probably benign Het
Tomm34 G A 2: 164,070,896 probably benign Het
Trank1 G A 9: 111,389,221 E1890K probably damaging Het
Wasf3 C T 5: 146,461,097 H225Y probably benign Het
Wdr37 A T 13: 8,847,674 probably null Het
Zbtb7c A C 18: 76,137,342 D167A probably benign Het
Zkscan4 A G 13: 21,481,328 T158A probably benign Het
Other mutations in Olfr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Olfr10 APN 11 49318300 nonsense probably null 0.00
IGL02283:Olfr10 APN 11 49318335 missense probably benign
IGL03010:Olfr10 APN 11 49318146 missense probably damaging 0.99
R0575:Olfr10 UTSW 11 49318053 missense probably damaging 1.00
R1430:Olfr10 UTSW 11 49318101 unclassified probably null
R1891:Olfr10 UTSW 11 49317857 missense probably benign 0.00
R2509:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R2511:Olfr10 UTSW 11 49318221 missense probably damaging 0.97
R4942:Olfr10 UTSW 11 49317548 start codon destroyed probably null 0.99
R5413:Olfr10 UTSW 11 49318413 missense probably damaging 1.00
R5843:Olfr10 UTSW 11 49318249 missense probably benign 0.34
R6354:Olfr10 UTSW 11 49317638 missense probably damaging 0.98
R6605:Olfr10 UTSW 11 49317714 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TATTTCTTGCTCTGGGATCCACAG -3'
(R):5'- GCCTTTCTGCGTGCAGTTAC -3'

Sequencing Primer
(F):5'- ACAGAGAGTGTGCTCCTGG -3'
(R):5'- GCGTGCAGTTACTGACTTGACC -3'
Posted On2016-06-06