Mutagenetix > Incidental Mutations

Incidental Mutation 'R5081:Ass1'

387108

Institutional Source

Beutler Lab

Gene Symbol

Ass1

Ensembl Gene

ENSMUSG00000076441

Gene Name

argininosuccinate synthetase 1

Synonyms

Ass-1, ASS, fold

MMRRC Submission

042670-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5081 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31470207-31520672 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 31488653 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000099904 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102840]

Predicted Effect

probably null
Transcript: ENSMUST00000102840

SMART Domains

Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441

Domain	Start	End	E-Value	Type
Pfam:QueC	6	93	2.8e-7	PFAM
Pfam:Arginosuc_synth	8	403	1.9e-177	PFAM

Meta Mutation Damage Score

0.9479

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.2%

Validation Efficiency

93% (65/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
AI593442	TGAGGAGGAGGAGGAGGA	TGAGGAGGAGGAGGA	9: 52,677,814		probably benign	Het
Aig1	A	G	10: 13,801,900	I116T	probably benign	Het
Alox12	A	T	11: 70,255,314		probably null	Het
Ap3s1	T	A	18: 46,754,430	D43E	probably benign	Het
Arhgap35	A	G	7: 16,565,134	M2T	possibly damaging	Het
Asah2	T	A	19: 32,014,308	E451V	probably benign	Het
Ash1l	T	G	3: 88,984,717	I1301S	probably damaging	Het
Ccpg1	A	G	9: 72,999,078	T39A	possibly damaging	Het
Cd101	T	A	3: 101,003,705	Y879F	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cdh23	T	C	10: 60,436,807	T530A	possibly damaging	Het
Cep68	G	T	11: 20,238,477	Q643K	probably damaging	Het
Ces1c	A	G	8: 93,127,569	S113P	probably damaging	Het
Cnga4	T	C	7: 105,407,025	I278T	probably benign	Het
Col1a1	A	G	11: 94,951,576	D1440G	unknown	Het
Cspp1	A	G	1: 10,047,466	I48V	possibly damaging	Het
Ctsj	T	A	13: 61,003,850	S85C	possibly damaging	Het
Cyp39a1	C	A	17: 43,746,597	D442E	probably damaging	Het
Dock3	A	T	9: 106,991,093	F664Y	probably damaging	Het
Gpcpd1	A	T	2: 132,547,702	H244Q	probably benign	Het
Gtf3a	T	A	5: 146,951,282	V131E	probably benign	Het
Gtpbp3	A	T	8: 71,490,382	R147W	probably damaging	Het
H2-Ke6	G	A	17: 34,027,578		probably benign	Het
H2-Oa	A	T	17: 34,094,370	I132F	probably damaging	Het
Idi1	T	A	13: 8,887,927	C91*	probably null	Het
Itga11	A	G	9: 62,755,196	I484V	probably benign	Het
Kpna3	C	T	14: 61,391,245	S101N	probably damaging	Het
Larp4	G	A	15: 99,973,017		probably benign	Het
Mink1	T	C	11: 70,605,144	L390P	probably damaging	Het
Morc1	T	G	16: 48,502,352	S337R	probably benign	Het
Myo10	A	G	15: 25,785,940	R1236G	probably damaging	Het
Nkx3-1	T	C	14: 69,191,947	I138T	possibly damaging	Het
Nnt	T	C	13: 119,366,400	N489S	probably damaging	Het
Nrcam	A	T	12: 44,570,353	I711F	probably benign	Het
Ntrk3	A	G	7: 78,577,774	S4P	probably damaging	Het
Obsl1	T	C	1: 75,487,963	T1605A	possibly damaging	Het
Olfr346	A	G	2: 36,688,643	I214V	possibly damaging	Het
Olfr851	A	G	9: 19,497,261	E171G	probably benign	Het
Pank1	T	C	19: 34,878,916	H54R	probably benign	Het
Pgm2l1	A	G	7: 100,268,265	I530V	probably benign	Het
Psmd2	A	G	16: 20,661,655	T709A	probably benign	Het
Qsox1	G	T	1: 155,812,835		probably benign	Het
Rbm14	A	G	19: 4,802,795	S520P	probably benign	Het
Rbm15b	G	A	9: 106,884,921	R683C	probably benign	Het
Rhbdd2	T	A	5: 135,636,022	V69D	probably damaging	Het
Sart1	T	C	19: 5,388,548	E27G	possibly damaging	Het
Scn4a	G	A	11: 106,348,727	P153L	probably damaging	Het
Serpinb6d	A	T	13: 33,671,247	R301S	probably benign	Het
Sf3a2	C	A	10: 80,804,441		probably benign	Het
Syne1	T	C	10: 5,047,767	D400G	probably benign	Het
Tenm2	T	C	11: 36,024,633	S2025G	possibly damaging	Het
Ttc16	A	T	2: 32,767,976	D476E	probably damaging	Het
Ttc9c	A	T	19: 8,816,032	C81*	probably null	Het
Ulk2	G	A	11: 61,803,662	P474L	probably damaging	Het
Vmn1r66	A	G	7: 10,274,795	C104R	probably damaging	Het
Vwa2	C	T	19: 56,909,320	H686Y	probably damaging	Het

Other mutations in Ass1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Ass1	APN	2	31476922	missense	probably damaging	1.00
IGL02152:Ass1	APN	2	31492324	missense	probably damaging	1.00
R0008:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0083:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0084:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0085:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0087:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0183:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0220:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0254:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0302:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0346:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0440:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0472:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0605:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R0644:Ass1	UTSW	2	31514819	missense	probably damaging	1.00
R1460:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1465:Ass1	UTSW	2	31520416	makesense	probably null
R1770:Ass1	UTSW	2	31486516	missense	probably benign	0.29
R1908:Ass1	UTSW	2	31493148	nonsense	probably null
R2361:Ass1	UTSW	2	31520382	missense	probably benign	0.02
R2430:Ass1	UTSW	2	31501496	missense	probably damaging	1.00
R3816:Ass1	UTSW	2	31510105	splice site	probably benign
R4614:Ass1	UTSW	2	31514783	missense	probably damaging	1.00
R4628:Ass1	UTSW	2	31480988	missense	probably damaging	1.00
R5007:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90
R5069:Ass1	UTSW	2	31510173	missense	probably damaging	1.00
R5315:Ass1	UTSW	2	31492329	missense	probably benign	0.21
R5370:Ass1	UTSW	2	31518733	missense	possibly damaging	0.56
R6259:Ass1	UTSW	2	31488642	missense	possibly damaging	0.80
R6541:Ass1	UTSW	2	31510233	missense	probably damaging	0.99
R6731:Ass1	UTSW	2	31514784	missense	probably damaging	1.00
R6927:Ass1	UTSW	2	31514801	missense	probably damaging	1.00
R7811:Ass1	UTSW	2	31514741	missense	probably benign	0.37
R7995:Ass1	UTSW	2	31486540	missense	probably benign	0.00
R8504:Ass1	UTSW	2	31501532	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TCCTTGTTCTTACGCCAAAGG -3'
(R):5'- TTTCCCTTAGAACAAGAGCAGGC -3'

Sequencing Primer
(F):5'- CGCCAAAGGGGTGTGTG -3'
(R):5'- TTAGAACAAGAGCAGGCATCCCG -3'

Posted On

2016-06-06