Incidental Mutation 'R0427:Med27'
ID38711
Institutional Source Beutler Lab
Gene Symbol Med27
Ensembl Gene ENSMUSG00000026799
Gene Namemediator complex subunit 27
SynonymsD2Ertd434e, Crsp8, 1500015J03Rik, 2310042P07Rik
MMRRC Submission 038629-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R0427 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29346819-29524793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29500271 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 70 (I70T)
Ref Sequence ENSEMBL: ENSMUSP00000125360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028139] [ENSMUST00000159280] [ENSMUST00000162597] [ENSMUST00000162623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028139
AA Change: I209T

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028139
Gene: ENSMUSG00000026799
AA Change: I209T

DomainStartEndE-ValueType
Pfam:Med27 228 310 7.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147547
Predicted Effect possibly damaging
Transcript: ENSMUST00000159280
AA Change: I70T

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125390
Gene: ENSMUSG00000026799
AA Change: I70T

DomainStartEndE-ValueType
Pfam:Med27 85 171 1.4e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162597
AA Change: I70T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000162603
AA Change: I153T
Predicted Effect probably benign
Transcript: ENSMUST00000162623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162773
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 43,652,456 T51P probably benign Het
Alpk1 A T 3: 127,671,071 V1186E probably damaging Het
Ankfn1 T C 11: 89,405,597 D102G probably damaging Het
Armc2 A G 10: 42,000,410 I127T possibly damaging Het
Atp6v1b2 T C 8: 69,101,432 L87P probably damaging Het
Atp9a T A 2: 168,640,697 probably null Het
BC048679 C G 7: 81,495,245 V123L probably benign Het
Birc7 G A 2: 180,929,514 probably null Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1d T A 14: 30,346,817 N155I probably damaging Het
Cd300lg T C 11: 102,043,026 V33A probably damaging Het
Cep290 A G 10: 100,516,179 D742G probably benign Het
Cep95 A G 11: 106,790,752 N14S probably benign Het
Cfap74 A T 4: 155,441,277 M728L probably benign Het
Ctsll3 T A 13: 60,801,391 T9S probably benign Het
Cyp3a44 A G 5: 145,779,602 S393P possibly damaging Het
Dmbt1 T A 7: 131,040,902 L150* probably null Het
Dnah2 A G 11: 69,452,879 I2868T probably damaging Het
Dopey1 A G 9: 86,507,532 H505R probably damaging Het
Exo1 A G 1: 175,905,953 K781R probably damaging Het
Fam184a A G 10: 53,690,115 Y459H probably damaging Het
Foxp1 C T 6: 98,930,203 D540N probably damaging Het
Fstl5 T A 3: 76,707,727 Y698* probably null Het
Gm13088 A T 4: 143,654,423 N343K probably benign Het
Gm5141 T C 13: 62,774,711 K215E probably damaging Het
Gm7102 A G 19: 61,175,470 Y176H probably damaging Het
Grik5 C A 7: 25,058,498 R386L probably benign Het
Ikbke A T 1: 131,257,910 S620R possibly damaging Het
Kcnh3 A T 15: 99,233,299 M518L probably benign Het
Lrrcc1 G T 3: 14,558,356 A748S probably damaging Het
Mbd5 T G 2: 49,279,079 S1191A probably benign Het
Myh4 A G 11: 67,258,653 D1737G probably damaging Het
Myo5a A G 9: 75,174,196 D1021G probably benign Het
Ncor1 T C 11: 62,410,920 E212G probably damaging Het
Neb A T 2: 52,243,884 N3362K possibly damaging Het
Neb A G 2: 52,244,069 S3301P probably damaging Het
Neurod1 T G 2: 79,454,182 K286Q probably damaging Het
Noc3l T C 19: 38,789,651 Q773R probably benign Het
Nup205 T A 6: 35,194,463 N420K probably benign Het
Olfml3 A T 3: 103,737,014 V113E probably benign Het
Olfr108 T A 17: 37,445,702 D60E probably damaging Het
Olfr128 A T 17: 37,923,629 H21L probably benign Het
Olfr155 A G 4: 43,854,417 Y36C probably damaging Het
Olfr342 C T 2: 36,527,982 S190L probably damaging Het
Opa1 T C 16: 29,611,461 V439A probably damaging Het
Pcdhb11 T C 18: 37,422,765 S383P probably damaging Het
Pkd1 T C 17: 24,593,502 V3803A probably damaging Het
Plekhg1 A G 10: 3,964,235 D1319G probably benign Het
Polq T A 16: 37,061,993 C1227* probably null Het
Psmc1 T C 12: 100,119,228 F283L probably damaging Het
Psmd8 T C 7: 29,176,127 N189S probably damaging Het
Ptger4 G A 15: 5,242,901 T104I probably benign Het
Ptpro T G 6: 137,368,296 V100G possibly damaging Het
Rab11fip1 T A 8: 27,154,492 T422S probably damaging Het
Rad54l2 A G 9: 106,693,692 L1143P possibly damaging Het
Rnf148 A G 6: 23,654,073 M308T probably damaging Het
Sbsn T A 7: 30,752,098 probably benign Het
Scube2 T A 7: 109,824,837 T487S probably benign Het
Sema4c C A 1: 36,553,811 E109* probably null Het
Sipa1l2 A T 8: 125,480,332 L544Q probably damaging Het
Slc28a2 A G 2: 122,458,221 T603A probably benign Het
Tbc1d7 T A 13: 43,153,087 T138S probably benign Het
Timd4 A T 11: 46,819,257 T239S probably benign Het
Trp53bp1 A G 2: 121,236,017 S743P probably damaging Het
Tspan10 T A 11: 120,444,294 Y77N probably damaging Het
Ttc14 T C 3: 33,803,484 S245P probably damaging Het
Ttf1 T A 2: 29,065,042 S139R probably benign Het
Tubd1 C A 11: 86,557,790 Q279K possibly damaging Het
Twnk A G 19: 45,007,587 E153G probably benign Het
Ush2a A G 1: 188,400,281 D900G probably damaging Het
Usp54 A G 14: 20,570,364 V691A probably benign Het
Usp8 T C 2: 126,718,032 probably benign Het
Vmn1r231 C T 17: 20,890,228 V142I probably benign Het
Vmn2r15 C T 5: 109,287,087 A584T probably damaging Het
Vmn2r6 A G 3: 64,559,587 S164P probably damaging Het
Vps16 A G 2: 130,438,850 Y233C probably benign Het
Vwf C G 6: 125,673,939 H2511D probably benign Het
Wipf3 T G 6: 54,483,897 L110R possibly damaging Het
Zfp945 T A 17: 22,865,252 N11I probably benign Het
Other mutations in Med27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Med27 APN 2 29413482 missense probably damaging 1.00
R1769:Med27 UTSW 2 29500295 missense probably damaging 0.99
R2126:Med27 UTSW 2 29524430 nonsense probably null
R3196:Med27 UTSW 2 29346870 missense possibly damaging 0.86
R4093:Med27 UTSW 2 29377908 unclassified probably benign
R4498:Med27 UTSW 2 29471342 missense probably damaging 0.99
R4599:Med27 UTSW 2 29524458 missense probably damaging 1.00
R4722:Med27 UTSW 2 29524435 missense probably damaging 0.98
R4771:Med27 UTSW 2 29413503 missense probably damaging 1.00
R4828:Med27 UTSW 2 29377938 unclassified probably benign
R5870:Med27 UTSW 2 29389811 critical splice acceptor site probably null
R6061:Med27 UTSW 2 29509441 missense probably damaging 0.99
R6159:Med27 UTSW 2 29524364 splice site probably null
R7028:Med27 UTSW 2 29509434 nonsense probably null
R7319:Med27 UTSW 2 29413478 missense possibly damaging 0.53
R7387:Med27 UTSW 2 29413407 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTCAGAATGTGGACAGATAAGCGGC -3'
(R):5'- CTGTGAGCAGCAGAGGTTTAGAACG -3'

Sequencing Primer
(F):5'- ACAGATAAGCGGCGGTCTC -3'
(R):5'- ATAGTATTTGTCAAGGGTCCCTC -3'
Posted On2013-05-23