Incidental Mutation 'R5081:Olfr346'
ID387110
Institutional Source Beutler Lab
Gene Symbol Olfr346
Ensembl Gene ENSMUSG00000094764
Gene Nameolfactory receptor 346
SynonymsMOR136-11, GA_x6K02T2NLDC-33382467-33383396
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5081 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36685788-36691293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36688643 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 214 (I214V)
Ref Sequence ENSEMBL: ENSMUSP00000149916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078854] [ENSMUST00000213258]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078854
AA Change: I214V

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077897
Gene: ENSMUSG00000094764
AA Change: I214V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-58 PFAM
Pfam:7tm_1 41 290 1.3e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213258
AA Change: I214V

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Ap3s1 T A 18: 46,754,430 D43E probably benign Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Asah2 T A 19: 32,014,308 E451V probably benign Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gpcpd1 A T 2: 132,547,702 H244Q probably benign Het
Gtf3a T A 5: 146,951,282 V131E probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Kpna3 C T 14: 61,391,245 S101N probably damaging Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Sart1 T C 19: 5,388,548 E27G possibly damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vmn1r66 A G 7: 10,274,795 C104R probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Olfr346
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Olfr346 APN 2 36688538 missense probably damaging 1.00
IGL01770:Olfr346 APN 2 36688105 missense probably benign 0.02
IGL02110:Olfr346 APN 2 36688685 missense probably benign
IGL02212:Olfr346 APN 2 36688182 missense probably damaging 0.98
IGL02346:Olfr346 APN 2 36688004 start codon destroyed probably benign 0.41
IGL02544:Olfr346 APN 2 36688836 missense probably damaging 1.00
IGL02995:Olfr346 APN 2 36688632 missense possibly damaging 0.56
IGL03154:Olfr346 APN 2 36688643 missense possibly damaging 0.78
IGL03389:Olfr346 APN 2 36688262 missense probably benign 0.12
R0100:Olfr346 UTSW 2 36688911 missense probably benign 0.00
R0230:Olfr346 UTSW 2 36688616 missense probably benign 0.01
R1559:Olfr346 UTSW 2 36688758 missense probably damaging 1.00
R1560:Olfr346 UTSW 2 36688143 missense probably damaging 1.00
R1614:Olfr346 UTSW 2 36688309 nonsense probably null
R1697:Olfr346 UTSW 2 36688247 missense probably damaging 1.00
R1738:Olfr346 UTSW 2 36688785 missense probably benign 0.44
R1966:Olfr346 UTSW 2 36688784 missense probably benign 0.01
R2021:Olfr346 UTSW 2 36688475 missense probably benign
R2181:Olfr346 UTSW 2 36688334 missense probably damaging 1.00
R4170:Olfr346 UTSW 2 36688722 missense probably damaging 0.98
R4625:Olfr346 UTSW 2 36688071 missense probably benign 0.06
R5335:Olfr346 UTSW 2 36688094 missense probably benign
R5966:Olfr346 UTSW 2 36688062 missense probably null 0.00
R5978:Olfr346 UTSW 2 36688682 missense probably benign 0.07
R6110:Olfr346 UTSW 2 36688547 missense probably benign 0.01
R6329:Olfr346 UTSW 2 36688682 nonsense probably null
R7214:Olfr346 UTSW 2 36688095 missense probably benign 0.35
R7301:Olfr346 UTSW 2 36688011 missense probably benign
R7382:Olfr346 UTSW 2 36688034 nonsense probably null
R7979:Olfr346 UTSW 2 36688094 missense probably benign 0.03
R8218:Olfr346 UTSW 2 36688673 missense probably benign 0.12
R8501:Olfr346 UTSW 2 36688797 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAATGCTCTTGTGCACACC -3'
(R):5'- GATTCAACATGGGTGTGACCAC -3'

Sequencing Primer
(F):5'- GTGCACACCCTTCTCTTGG -3'
(R):5'- GTGTGACCACAGTGTACATCATAGC -3'
Posted On2016-06-06