Incidental Mutation 'R5081:Vmn1r66'
ID387118
Institutional Source Beutler Lab
Gene Symbol Vmn1r66
Ensembl Gene ENSMUSG00000043066
Gene Namevomeronasal 1 receptor 66
SynonymsV1re11
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5081 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10272991-10278006 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10274795 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 104 (C104R)
Ref Sequence ENSEMBL: ENSMUSP00000153860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060374] [ENSMUST00000227719] [ENSMUST00000228086] [ENSMUST00000228622]
Predicted Effect probably damaging
Transcript: ENSMUST00000060374
AA Change: C104R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055861
Gene: ENSMUSG00000043066
AA Change: C104R

DomainStartEndE-ValueType
Pfam:V1R 39 295 4.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226202
Predicted Effect probably damaging
Transcript: ENSMUST00000227719
AA Change: C104R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228086
AA Change: C104R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228622
AA Change: C104R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6995 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Ap3s1 T A 18: 46,754,430 D43E probably benign Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Asah2 T A 19: 32,014,308 E451V probably benign Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gpcpd1 A T 2: 132,547,702 H244Q probably benign Het
Gtf3a T A 5: 146,951,282 V131E probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Kpna3 C T 14: 61,391,245 S101N probably damaging Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr346 A G 2: 36,688,643 I214V possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Sart1 T C 19: 5,388,548 E27G possibly damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Vmn1r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn1r66 APN 7 10274810 missense probably damaging 1.00
IGL03236:Vmn1r66 APN 7 10275063 missense probably damaging 0.98
R0380:Vmn1r66 UTSW 7 10274743 missense probably benign 0.02
R1625:Vmn1r66 UTSW 7 10274389 missense probably benign 0.00
R3745:Vmn1r66 UTSW 7 10274321 missense possibly damaging 0.64
R4081:Vmn1r66 UTSW 7 10274806 missense probably damaging 1.00
R4389:Vmn1r66 UTSW 7 10274788 nonsense probably null
R5909:Vmn1r66 UTSW 7 10274342 missense probably benign 0.44
R6164:Vmn1r66 UTSW 7 10274402 nonsense probably null
R6792:Vmn1r66 UTSW 7 10274485 missense possibly damaging 0.78
R6843:Vmn1r66 UTSW 7 10274765 missense probably damaging 1.00
R7013:Vmn1r66 UTSW 7 10274756 missense possibly damaging 0.94
R7173:Vmn1r66 UTSW 7 10274555 missense probably benign 0.00
R7400:Vmn1r66 UTSW 7 10274947 missense probably damaging 0.99
Z1176:Vmn1r66 UTSW 7 10274285 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTAATGCTGCATAAACTGAGTG -3'
(R):5'- CACACAGCTTTGATTCTCATGC -3'

Sequencing Primer
(F):5'- TGGTTAACATAGGAGCAGTACTC -3'
(R):5'- ATTCTCATGCACCTCTGGGGAG -3'
Posted On2016-06-06