Incidental Mutation 'R5081:Kpna3'
ID387148
Institutional Source Beutler Lab
Gene Symbol Kpna3
Ensembl Gene ENSMUSG00000021929
Gene Namekaryopherin (importin) alpha 3
SynonymsIPOA4
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.622) question?
Stock #R5081 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61365211-61439874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61391245 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 101 (S101N)
Ref Sequence ENSEMBL: ENSMUSP00000022496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022496]
Predicted Effect probably damaging
Transcript: ENSMUST00000022496
AA Change: S101N

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022496
Gene: ENSMUSG00000021929
AA Change: S101N

DomainStartEndE-ValueType
Pfam:IBB 7 93 1e-25 PFAM
ARM 103 144 9.52e-11 SMART
ARM 146 186 2.15e-9 SMART
ARM 188 229 8.59e0 SMART
ARM 232 271 1.78e-1 SMART
ARM 273 313 4.31e-9 SMART
ARM 315 355 5.91e-7 SMART
ARM 357 397 5.22e-8 SMART
ARM 400 440 1.51e-4 SMART
Pfam:Arm_3 447 499 5.4e-25 PFAM
Meta Mutation Damage Score 0.1424 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The transport of molecules between the nucleus and the cytoplasm in eukaryotic cells is mediated by the nuclear pore complex (NPC), which consists of 60-100 proteins. Small molecules (up to 70 kD) can pass through the nuclear pore by nonselective diffusion while larger molecules are transported by an active process. The protein encoded by this gene belongs to the importin alpha family, and is involved in nuclear protein import. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null mutation are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Ap3s1 T A 18: 46,754,430 D43E probably benign Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Asah2 T A 19: 32,014,308 E451V probably benign Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gpcpd1 A T 2: 132,547,702 H244Q probably benign Het
Gtf3a T A 5: 146,951,282 V131E probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr346 A G 2: 36,688,643 I214V possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Sart1 T C 19: 5,388,548 E27G possibly damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vmn1r66 A G 7: 10,274,795 C104R probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Kpna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Kpna3 APN 14 61374288 missense possibly damaging 0.94
IGL00321:Kpna3 APN 14 61391853 splice site probably benign
IGL01013:Kpna3 APN 14 61370517 missense probably damaging 1.00
IGL01833:Kpna3 APN 14 61370445 missense possibly damaging 0.92
IGL02661:Kpna3 APN 14 61372949 splice site probably benign
IGL03070:Kpna3 APN 14 61370782 splice site probably benign
R1428:Kpna3 UTSW 14 61383220 splice site probably benign
R1719:Kpna3 UTSW 14 61387477 missense probably damaging 1.00
R1728:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R1760:Kpna3 UTSW 14 61370541 missense probably benign 0.03
R1784:Kpna3 UTSW 14 61367701 missense probably benign 0.00
R2107:Kpna3 UTSW 14 61370484 missense possibly damaging 0.52
R4184:Kpna3 UTSW 14 61368175 missense probably damaging 0.96
R4952:Kpna3 UTSW 14 61370389 missense probably damaging 1.00
R5766:Kpna3 UTSW 14 61403014 missense probably benign 0.07
R5887:Kpna3 UTSW 14 61403012 missense probably benign 0.04
R5927:Kpna3 UTSW 14 61384647 missense probably damaging 0.96
R7116:Kpna3 UTSW 14 61368186 missense probably benign 0.32
R7615:Kpna3 UTSW 14 61372962 missense possibly damaging 0.81
R7674:Kpna3 UTSW 14 61367637 missense probably benign
R7799:Kpna3 UTSW 14 61384733 missense probably damaging 1.00
R8115:Kpna3 UTSW 14 61370918 missense probably damaging 1.00
R8239:Kpna3 UTSW 14 61387470 missense probably damaging 1.00
R8896:Kpna3 UTSW 14 61391845 missense not run
Predicted Primers PCR Primer
(F):5'- ACTCATAGGCAAATGGTGACTC -3'
(R):5'- TCCAGTTGAGTGCTGTGCAG -3'

Sequencing Primer
(F):5'- TATAGCTCAGTGCAGTGAACCTG -3'
(R):5'- CAGGCAGCAAGGTAAGAGAAAGC -3'
Posted On2016-06-06