Incidental Mutation 'R5081:Ap3s1'
ID387158
Institutional Source Beutler Lab
Gene Symbol Ap3s1
Ensembl Gene ENSMUSG00000024480
Gene Nameadaptor-related protein complex 3, sigma 1 subunit
Synonyms[s]3A
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5081 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location46741876-46790826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46754430 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 43 (D43E)
Ref Sequence ENSEMBL: ENSMUSP00000025357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025357] [ENSMUST00000224622] [ENSMUST00000225415] [ENSMUST00000225520] [ENSMUST00000226108]
Predicted Effect probably benign
Transcript: ENSMUST00000025357
AA Change: D43E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000025357
Gene: ENSMUSG00000024480
AA Change: D43E

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 1 148 1.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224622
AA Change: D43E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000225415
AA Change: D43E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000225520
AA Change: D43E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000226108
AA Change: D43E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: This gene encodes the sigma subunit of the heterotetrameric adaptor protein complex AP-3 which is involved in the formation of specialized lysosome-related compartments such as melanosomes. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on chromosomes 1, 8, 16, 17 and X. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Asah2 T A 19: 32,014,308 E451V probably benign Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gpcpd1 A T 2: 132,547,702 H244Q probably benign Het
Gtf3a T A 5: 146,951,282 V131E probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Kpna3 C T 14: 61,391,245 S101N probably damaging Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr346 A G 2: 36,688,643 I214V possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Sart1 T C 19: 5,388,548 E27G possibly damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vmn1r66 A G 7: 10,274,795 C104R probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Ap3s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0087:Ap3s1 UTSW 18 46758039 missense probably damaging 1.00
R0410:Ap3s1 UTSW 18 46779212 missense probably benign 0.02
R2102:Ap3s1 UTSW 18 46754402 missense possibly damaging 0.88
R4234:Ap3s1 UTSW 18 46779200 missense probably benign 0.28
R4500:Ap3s1 UTSW 18 46790000 missense possibly damaging 0.47
R4894:Ap3s1 UTSW 18 46758116 critical splice donor site probably null
R6063:Ap3s1 UTSW 18 46754438 missense probably benign 0.02
R6209:Ap3s1 UTSW 18 46779251 missense probably benign 0.00
R6250:Ap3s1 UTSW 18 46754447 missense probably damaging 1.00
R6401:Ap3s1 UTSW 18 46758007 missense probably benign 0.00
R6575:Ap3s1 UTSW 18 46754381 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCTTTGGCTAGCTCATGTC -3'
(R):5'- AGACTTATACCTACGAGTGGTAGC -3'

Sequencing Primer
(F):5'- ACAAGTGTGTCTGAGTTTTACAAGTG -3'
(R):5'- CCTACGAGTGGTAGCAATGAAATTAC -3'
Posted On2016-06-06