Incidental Mutation 'R5081:Sart1'
ID387160
Institutional Source Beutler Lab
Gene Symbol Sart1
Ensembl Gene ENSMUSG00000039148
Gene Namesquamous cell carcinoma antigen recognized by T cells 1
SynonymsU5-110K
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5081 (G1)
Quality Score90
Status Validated
Chromosome19
Chromosomal Location5377523-5388703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5388548 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 27 (E27G)
Ref Sequence ENSEMBL: ENSMUSP00000047397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044207] [ENSMUST00000044527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044207
AA Change: E27G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047397
Gene: ENSMUSG00000039148
AA Change: E27G

DomainStartEndE-ValueType
low complexity region 13 26 N/A INTRINSIC
low complexity region 31 83 N/A INTRINSIC
Pfam:SART-1 117 759 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044527
SMART Domains Protein: ENSMUSP00000047408
Gene: ENSMUSG00000039330

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
coiled coil region 33 63 N/A INTRINSIC
Meta Mutation Damage Score 0.0827 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes two proteins, the SART1(800) protein expressed in the nucleus of the majority of proliferating cells, and the SART1(259) protein expressed in the cytosol of epithelial cancers. The SART1(259) protein is translated by the mechanism of -1 frameshifting during posttranscriptional regulation; its full-length sequence is not published yet. The two encoded proteins are thought to be involved in the regulation of proliferation. Both proteins have tumor-rejection antigens. The SART1(259) protein possesses tumor epitopes capable of inducing HLA-A2402-restricted cytotoxic T lymphocytes in cancer patients. This SART1(259) antigen may be useful in specific immunotherapy for cancer patients and may serve as a paradigmatic tool for the diagnosis and treatment of patients with atopy. The SART1(259) protein is found to be essential for the recruitment of the tri-snRNP to the pre-spliceosome in the spliceosome assembly pathway. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Ap3s1 T A 18: 46,754,430 D43E probably benign Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Asah2 T A 19: 32,014,308 E451V probably benign Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gpcpd1 A T 2: 132,547,702 H244Q probably benign Het
Gtf3a T A 5: 146,951,282 V131E probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Kpna3 C T 14: 61,391,245 S101N probably damaging Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr346 A G 2: 36,688,643 I214V possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vmn1r66 A G 7: 10,274,795 C104R probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Sart1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Sart1 APN 19 5383951 missense probably benign 0.00
IGL02390:Sart1 APN 19 5380461 missense possibly damaging 0.85
IGL02533:Sart1 APN 19 5383721 nonsense probably null
IGL03094:Sart1 APN 19 5384081 splice site probably benign
R0219:Sart1 UTSW 19 5388396 missense probably benign
R0226:Sart1 UTSW 19 5381122 splice site probably benign
R0304:Sart1 UTSW 19 5380531 splice site probably benign
R0537:Sart1 UTSW 19 5381724 missense probably damaging 0.99
R0668:Sart1 UTSW 19 5384256 missense probably damaging 1.00
R1574:Sart1 UTSW 19 5380259 missense probably damaging 1.00
R1574:Sart1 UTSW 19 5380259 missense probably damaging 1.00
R1674:Sart1 UTSW 19 5385825 missense probably damaging 0.99
R4077:Sart1 UTSW 19 5382743 missense possibly damaging 0.48
R4866:Sart1 UTSW 19 5382220 missense probably damaging 1.00
R5523:Sart1 UTSW 19 5383676 missense probably damaging 0.99
R5756:Sart1 UTSW 19 5380469 missense probably damaging 1.00
R5875:Sart1 UTSW 19 5383795 missense probably damaging 1.00
R5979:Sart1 UTSW 19 5381223 missense probably damaging 1.00
R7360:Sart1 UTSW 19 5383203 missense probably damaging 0.96
R7560:Sart1 UTSW 19 5384877 missense probably damaging 0.97
R7764:Sart1 UTSW 19 5388585 missense probably damaging 1.00
R8426:Sart1 UTSW 19 5383741 missense probably benign
R8517:Sart1 UTSW 19 5383197 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGACGTCTTTAACCCGAGAG -3'
(R):5'- TTAGTTTCCGGCAACAGGAAC -3'

Sequencing Primer
(F):5'- GTAGCCGTCATCGCGTTTC -3'
(R):5'- ACAGGAACGGGGCGGTC -3'
Posted On2016-06-06