Incidental Mutation 'R5081:Asah2'
ID387162
Institutional Source Beutler Lab
Gene Symbol Asah2
Ensembl Gene ENSMUSG00000024887
Gene NameN-acylsphingosine amidohydrolase 2
Synonymsneutral/alkaline ceramidase
MMRRC Submission 042670-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5081 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location31984654-32061469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32014308 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 451 (E451V)
Ref Sequence ENSEMBL: ENSMUSP00000093830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096119]
Predicted Effect probably benign
Transcript: ENSMUST00000096119
AA Change: E451V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000093830
Gene: ENSMUSG00000024887
AA Change: E451V

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 56 67 N/A INTRINSIC
Pfam:Ceramidase_alk 78 584 1.4e-222 PFAM
Pfam:Ceramidse_alk_C 586 753 8e-50 PFAM
Meta Mutation Damage Score 0.1253 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency 93% (65/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ceramidases (EC 3.5.1.23), such as ASAH2, catalyze hydrolysis of the N-acyl linkage of ceramide, a second messenger in a variety of cellular events, to produce sphingosine. Sphingosine exerts both mitogenic and apoptosis-inducing activities, and its phosphorylated form functions as an intra- and intercellular second messenger (see MIM 603730) (Mitsutake et al., 2001 [PubMed 11328816]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are defective in the intestinal digestion of dietary ceramide but exhibit a normal life span with no obvious abnormalities or significant alterations in total ceramide levels in major organ tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
AI593442 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGA 9: 52,677,814 probably benign Het
Aig1 A G 10: 13,801,900 I116T probably benign Het
Alox12 A T 11: 70,255,314 probably null Het
Ap3s1 T A 18: 46,754,430 D43E probably benign Het
Arhgap35 A G 7: 16,565,134 M2T possibly damaging Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Ass1 G A 2: 31,488,653 probably null Het
Ccpg1 A G 9: 72,999,078 T39A possibly damaging Het
Cd101 T A 3: 101,003,705 Y879F possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh23 T C 10: 60,436,807 T530A possibly damaging Het
Cep68 G T 11: 20,238,477 Q643K probably damaging Het
Ces1c A G 8: 93,127,569 S113P probably damaging Het
Cnga4 T C 7: 105,407,025 I278T probably benign Het
Col1a1 A G 11: 94,951,576 D1440G unknown Het
Cspp1 A G 1: 10,047,466 I48V possibly damaging Het
Ctsj T A 13: 61,003,850 S85C possibly damaging Het
Cyp39a1 C A 17: 43,746,597 D442E probably damaging Het
Dock3 A T 9: 106,991,093 F664Y probably damaging Het
Gpcpd1 A T 2: 132,547,702 H244Q probably benign Het
Gtf3a T A 5: 146,951,282 V131E probably benign Het
Gtpbp3 A T 8: 71,490,382 R147W probably damaging Het
H2-Ke6 G A 17: 34,027,578 probably benign Het
H2-Oa A T 17: 34,094,370 I132F probably damaging Het
Idi1 T A 13: 8,887,927 C91* probably null Het
Itga11 A G 9: 62,755,196 I484V probably benign Het
Kpna3 C T 14: 61,391,245 S101N probably damaging Het
Larp4 G A 15: 99,973,017 probably benign Het
Mink1 T C 11: 70,605,144 L390P probably damaging Het
Morc1 T G 16: 48,502,352 S337R probably benign Het
Myo10 A G 15: 25,785,940 R1236G probably damaging Het
Nkx3-1 T C 14: 69,191,947 I138T possibly damaging Het
Nnt T C 13: 119,366,400 N489S probably damaging Het
Nrcam A T 12: 44,570,353 I711F probably benign Het
Ntrk3 A G 7: 78,577,774 S4P probably damaging Het
Obsl1 T C 1: 75,487,963 T1605A possibly damaging Het
Olfr346 A G 2: 36,688,643 I214V possibly damaging Het
Olfr851 A G 9: 19,497,261 E171G probably benign Het
Pank1 T C 19: 34,878,916 H54R probably benign Het
Pgm2l1 A G 7: 100,268,265 I530V probably benign Het
Psmd2 A G 16: 20,661,655 T709A probably benign Het
Qsox1 G T 1: 155,812,835 probably benign Het
Rbm14 A G 19: 4,802,795 S520P probably benign Het
Rbm15b G A 9: 106,884,921 R683C probably benign Het
Rhbdd2 T A 5: 135,636,022 V69D probably damaging Het
Sart1 T C 19: 5,388,548 E27G possibly damaging Het
Scn4a G A 11: 106,348,727 P153L probably damaging Het
Serpinb6d A T 13: 33,671,247 R301S probably benign Het
Sf3a2 C A 10: 80,804,441 probably benign Het
Syne1 T C 10: 5,047,767 D400G probably benign Het
Tenm2 T C 11: 36,024,633 S2025G possibly damaging Het
Ttc16 A T 2: 32,767,976 D476E probably damaging Het
Ttc9c A T 19: 8,816,032 C81* probably null Het
Ulk2 G A 11: 61,803,662 P474L probably damaging Het
Vmn1r66 A G 7: 10,274,795 C104R probably damaging Het
Vwa2 C T 19: 56,909,320 H686Y probably damaging Het
Other mutations in Asah2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Asah2 APN 19 32008681 splice site probably benign
IGL02001:Asah2 APN 19 32043539 nonsense probably null
IGL02228:Asah2 APN 19 32016714 missense probably benign 0.09
IGL02377:Asah2 APN 19 32009414 missense probably benign 0.30
IGL03070:Asah2 APN 19 32006344 missense probably damaging 1.00
IGL03233:Asah2 APN 19 32054631 missense probably benign 0.18
IGL03244:Asah2 APN 19 31986942 missense probably damaging 1.00
R0008:Asah2 UTSW 19 32003731 nonsense probably null
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0103:Asah2 UTSW 19 32018977 missense probably benign 0.01
R0302:Asah2 UTSW 19 32052956 missense probably benign 0.01
R0497:Asah2 UTSW 19 32054631 missense probably benign 0.18
R0614:Asah2 UTSW 19 32016728 missense probably damaging 1.00
R0639:Asah2 UTSW 19 32008639 missense probably damaging 0.99
R0715:Asah2 UTSW 19 32016776 missense probably damaging 0.97
R1332:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R1336:Asah2 UTSW 19 32044941 missense probably damaging 1.00
R2045:Asah2 UTSW 19 32052956 missense probably benign 0.01
R2062:Asah2 UTSW 19 32024874 missense probably damaging 0.99
R4083:Asah2 UTSW 19 31986784 missense probably benign 0.01
R4698:Asah2 UTSW 19 32054471 splice site probably null
R4731:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4732:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4733:Asah2 UTSW 19 31995358 missense probably benign 0.41
R4773:Asah2 UTSW 19 32052858 missense probably damaging 1.00
R4930:Asah2 UTSW 19 32052906 missense probably benign 0.35
R5741:Asah2 UTSW 19 32008615 missense probably damaging 1.00
R5873:Asah2 UTSW 19 32003682 critical splice donor site probably null
R5905:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6027:Asah2 UTSW 19 32044951 missense probably benign 0.01
R6028:Asah2 UTSW 19 32016514 missense probably damaging 1.00
R6187:Asah2 UTSW 19 32024867 missense probably damaging 0.99
R6667:Asah2 UTSW 19 31995358 missense probably benign 0.41
R6968:Asah2 UTSW 19 32012513 missense probably benign
R7010:Asah2 UTSW 19 32054554 missense probably benign 0.00
R7404:Asah2 UTSW 19 32057854 missense probably benign 0.13
R7575:Asah2 UTSW 19 32016703 missense probably benign 0.11
R7797:Asah2 UTSW 19 32022361 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCTTCCGTGTCAGTGGAC -3'
(R):5'- TTTGGGAGTGTCAGACAAAATG -3'

Sequencing Primer
(F):5'- CTGTGAAGCAGGATTGGT -3'
(R):5'- TTGGGAGTGTCAGACAAAATGTATTG -3'
Posted On2016-06-06