Incidental Mutation 'R5082:Gm14295'
ID387172
Institutional Source Beutler Lab
Gene Symbol Gm14295
Ensembl Gene ENSMUSG00000078877
Gene Namepredicted gene 14295
Synonyms
MMRRC Submission 042671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R5082 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location176798612-176811223 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 176807417 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 19 (L19*)
Ref Sequence ENSEMBL: ENSMUSP00000136320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118012] [ENSMUST00000132883] [ENSMUST00000179435]
Predicted Effect probably null
Transcript: ENSMUST00000118012
AA Change: L20*
SMART Domains Protein: ENSMUSP00000113133
Gene: ENSMUSG00000078877
AA Change: L20*

DomainStartEndE-ValueType
KRAB 4 64 5.2e-13 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132883
AA Change: L20*
SMART Domains Protein: ENSMUSP00000119262
Gene: ENSMUSG00000078877
AA Change: L20*

DomainStartEndE-ValueType
KRAB 4 66 6.97e-14 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 2.27e-4 SMART
ZnF_C2H2 187 209 2.61e-4 SMART
ZnF_C2H2 215 237 5.5e-3 SMART
ZnF_C2H2 243 265 2.4e-3 SMART
ZnF_C2H2 271 293 6.32e-3 SMART
ZnF_C2H2 299 321 4.17e-3 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 6.88e-4 SMART
ZnF_C2H2 383 405 9.22e-5 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 9.22e-5 SMART
ZnF_C2H2 467 489 1.67e-2 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
ZnF_C2H2 523 545 1.3e-4 SMART
ZnF_C2H2 551 573 1.67e-2 SMART
ZnF_C2H2 579 601 3.16e-3 SMART
ZnF_C2H2 607 629 6.78e-3 SMART
ZnF_C2H2 635 657 4.54e-4 SMART
ZnF_C2H2 663 685 4.54e-4 SMART
ZnF_C2H2 691 713 1.67e-2 SMART
ZnF_C2H2 719 741 3.16e-3 SMART
ZnF_C2H2 747 769 1.38e-3 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 823 8.75e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179435
AA Change: L19*
SMART Domains Protein: ENSMUSP00000136320
Gene: ENSMUSG00000078877
AA Change: L19*

DomainStartEndE-ValueType
KRAB 3 63 5.2e-13 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,131,868 M1015L probably benign Het
Aftph T C 11: 20,727,100 S170G probably damaging Het
Aox4 C T 1: 58,231,483 P274S possibly damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
Aspm T A 1: 139,478,676 L1767* probably null Het
Baz2b T A 2: 59,901,491 K2068* probably null Het
Bcl9 A T 3: 97,209,902 V492D probably damaging Het
Bicc1 G T 10: 70,940,522 H782Q probably benign Het
Cabin1 T A 10: 75,738,330 I640F probably damaging Het
Ccng1 A G 11: 40,752,188 V144A possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ddx1 G T 12: 13,220,435 C668* probably null Het
Dhx58 G A 11: 100,696,976 S585L probably benign Het
Dnttip2 A T 3: 122,275,941 K268N probably damaging Het
Ecd C T 14: 20,324,368 probably null Het
Entpd1 A G 19: 40,725,029 probably null Het
Erlin2 T C 8: 27,033,407 V224A probably damaging Het
Exoc3l4 A G 12: 111,427,990 S515G probably benign Het
Fcho1 T C 8: 71,717,185 D98G possibly damaging Het
Fhod1 T A 8: 105,330,513 D943V probably damaging Het
Gm10322 A T 10: 59,616,268 E69V possibly damaging Het
Gm7347 T A 5: 26,057,374 R50* probably null Het
Hesx1 T C 14: 27,000,774 C19R probably benign Het
Hgh1 T A 15: 76,369,552 F199L probably benign Het
Irak2 T C 6: 113,672,844 F147L probably damaging Het
Kif22 G A 7: 127,033,377 R254C possibly damaging Het
Klhl9 A T 4: 88,721,385 S206R probably damaging Het
Maip1 T C 1: 57,411,851 probably null Het
Mcm9 T A 10: 53,538,060 E308V possibly damaging Het
Mfsd13b A T 7: 120,998,978 N369I possibly damaging Het
Mga T A 2: 119,903,344 H224Q probably damaging Het
Mtss1 A T 15: 58,971,019 W115R probably damaging Het
Myo3b T C 2: 70,258,030 V851A probably benign Het
Nectin2 A T 7: 19,738,124 D113E probably damaging Het
Notch2 G A 3: 98,100,374 C480Y probably damaging Het
Olfr711 G A 7: 106,971,664 R227C probably benign Het
Olfr922 T C 9: 38,816,145 I214T possibly damaging Het
Pfdn1 G T 18: 36,404,413 N111K probably damaging Het
Pfkl A T 10: 77,996,408 V283E probably damaging Het
Plbd2 G T 5: 120,491,184 S305* probably null Het
Prom1 T C 5: 44,000,832 probably null Het
Ptbp2 T A 3: 119,752,964 M90L probably benign Het
Rai1 G A 11: 60,185,919 E270K possibly damaging Het
Rbbp6 G A 7: 123,000,702 probably benign Het
Reln T C 5: 21,896,077 M3399V probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sh2d2a A G 3: 87,851,784 D231G probably benign Het
Smn1 T C 13: 100,137,382 probably benign Het
Snrnp200 C T 2: 127,226,370 Q877* probably null Het
Taf2 G T 15: 55,060,045 H279N probably benign Het
Tnfaip3 T C 10: 19,005,284 Y345C probably damaging Het
Vmn2r68 C T 7: 85,233,868 M225I probably benign Het
Vps13a A T 19: 16,744,893 W352R probably damaging Het
Other mutations in Gm14295
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Gm14295 UTSW 2 176807364 missense probably damaging 1.00
R2061:Gm14295 UTSW 2 176810681 nonsense probably null
R2172:Gm14295 UTSW 2 176811102 missense possibly damaging 0.48
R2411:Gm14295 UTSW 2 176807413 missense probably benign 0.29
R4472:Gm14295 UTSW 2 176809593 missense possibly damaging 0.71
R4949:Gm14295 UTSW 2 176809676 missense probably damaging 0.99
R5311:Gm14295 UTSW 2 176810672 missense probably benign 0.00
R5792:Gm14295 UTSW 2 176811014 missense probably benign 0.10
R6170:Gm14295 UTSW 2 176811144 unclassified probably benign
R6267:Gm14295 UTSW 2 176808989 nonsense probably null
R6286:Gm14295 UTSW 2 176809568 missense possibly damaging 0.52
R6743:Gm14295 UTSW 2 176810627 missense probably damaging 1.00
R7456:Gm14295 UTSW 2 176809150 missense possibly damaging 0.95
R7536:Gm14295 UTSW 2 176810929 missense possibly damaging 0.74
R8049:Gm14295 UTSW 2 176809078 missense probably benign 0.03
R8126:Gm14295 UTSW 2 176810865 missense probably benign 0.04
R8209:Gm14295 UTSW 2 176811177 missense unknown
R8292:Gm14295 UTSW 2 176809558 missense probably damaging 0.99
R8356:Gm14295 UTSW 2 176809514 missense probably benign 0.24
R8412:Gm14295 UTSW 2 176809629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTCCAACTGTGAAAGACTGG -3'
(R):5'- CCCAGTACCAGAGAAAGTATGTTAC -3'

Sequencing Primer
(F):5'- CTGGATAAAAAGTACTATGTGGGTG -3'
(R):5'- CCATTGAACTTTAAAACCATGAGTG -3'
Posted On2016-06-06