Mutagenetix > Incidental Mutations

Incidental Mutation 'R5082:Dnttip2'

387178

Institutional Source

Beutler Lab

Gene Symbol

Dnttip2

Ensembl Gene

ENSMUSG00000039756

Gene Name

deoxynucleotidyltransferase, terminal, interacting protein 2

Synonyms

4930588M11Rik

MMRRC Submission

042671-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R5082 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122274388-122285271 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122275941 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 268 (K268N)

Ref Sequence

ENSEMBL: ENSMUSP00000045043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035776]

Predicted Effect

probably damaging
Transcript: ENSMUST00000035776
AA Change: K268N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: K268N

Domain	Start	End	E-Value	Type
low complexity region	125	143	N/A	INTRINSIC
low complexity region	447	458	N/A	INTRINSIC
coiled coil region	513	541	N/A	INTRINSIC
low complexity region	550	565	N/A	INTRINSIC
Pfam:Fcf2	639	733	3.4e-41	PFAM
low complexity region	748	756	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000072769

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196338

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197215

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199627

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	A	11: 110,131,868	M1015L	probably benign	Het
Aftph	T	C	11: 20,727,100	S170G	probably damaging	Het
Aox4	C	T	1: 58,231,483	P274S	possibly damaging	Het
Ash1l	G	A	3: 88,966,234	R108Q	probably damaging	Het
Aspm	T	A	1: 139,478,676	L1767*	probably null	Het
Baz2b	T	A	2: 59,901,491	K2068*	probably null	Het
Bcl9	A	T	3: 97,209,902	V492D	probably damaging	Het
Bicc1	G	T	10: 70,940,522	H782Q	probably benign	Het
Cabin1	T	A	10: 75,738,330	I640F	probably damaging	Het
Ccng1	A	G	11: 40,752,188	V144A	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Ddx1	G	T	12: 13,220,435	C668*	probably null	Het
Dhx58	G	A	11: 100,696,976	S585L	probably benign	Het
Ecd	C	T	14: 20,324,368		probably null	Het
Entpd1	A	G	19: 40,725,029		probably null	Het
Erlin2	T	C	8: 27,033,407	V224A	probably damaging	Het
Exoc3l4	A	G	12: 111,427,990	S515G	probably benign	Het
Fcho1	T	C	8: 71,717,185	D98G	possibly damaging	Het
Fhod1	T	A	8: 105,330,513	D943V	probably damaging	Het
Gm10322	A	T	10: 59,616,268	E69V	possibly damaging	Het
Gm14295	T	A	2: 176,807,417	L19*	probably null	Het
Gm7347	T	A	5: 26,057,374	R50*	probably null	Het
Hesx1	T	C	14: 27,000,774	C19R	probably benign	Het
Hgh1	T	A	15: 76,369,552	F199L	probably benign	Het
Irak2	T	C	6: 113,672,844	F147L	probably damaging	Het
Kif22	G	A	7: 127,033,377	R254C	possibly damaging	Het
Klhl9	A	T	4: 88,721,385	S206R	probably damaging	Het
Maip1	T	C	1: 57,411,851		probably null	Het
Mcm9	T	A	10: 53,538,060	E308V	possibly damaging	Het
Mfsd13b	A	T	7: 120,998,978	N369I	possibly damaging	Het
Mga	T	A	2: 119,903,344	H224Q	probably damaging	Het
Mtss1	A	T	15: 58,971,019	W115R	probably damaging	Het
Myo3b	T	C	2: 70,258,030	V851A	probably benign	Het
Nectin2	A	T	7: 19,738,124	D113E	probably damaging	Het
Notch2	G	A	3: 98,100,374	C480Y	probably damaging	Het
Olfr711	G	A	7: 106,971,664	R227C	probably benign	Het
Olfr922	T	C	9: 38,816,145	I214T	possibly damaging	Het
Pfdn1	G	T	18: 36,404,413	N111K	probably damaging	Het
Pfkl	A	T	10: 77,996,408	V283E	probably damaging	Het
Plbd2	G	T	5: 120,491,184	S305*	probably null	Het
Prom1	T	C	5: 44,000,832		probably null	Het
Ptbp2	T	A	3: 119,752,964	M90L	probably benign	Het
Rai1	G	A	11: 60,185,919	E270K	possibly damaging	Het
Rbbp6	G	A	7: 123,000,702		probably benign	Het
Reln	T	C	5: 21,896,077	M3399V	probably benign	Het
Ros1	T	A	10: 52,163,941	Y318F	possibly damaging	Het
Sh2d2a	A	G	3: 87,851,784	D231G	probably benign	Het
Smn1	T	C	13: 100,137,382		probably benign	Het
Snrnp200	C	T	2: 127,226,370	Q877*	probably null	Het
Taf2	G	T	15: 55,060,045	H279N	probably benign	Het
Tnfaip3	T	C	10: 19,005,284	Y345C	probably damaging	Het
Vmn2r68	C	T	7: 85,233,868	M225I	probably benign	Het
Vps13a	A	T	19: 16,744,893	W352R	probably damaging	Het

Other mutations in Dnttip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00535:Dnttip2	APN	3	122284499	missense	probably damaging	1.00
IGL00921:Dnttip2	APN	3	122275290	missense	probably benign	0.03
IGL01120:Dnttip2	APN	3	122278737	splice site	probably benign
IGL01341:Dnttip2	APN	3	122276612	missense	probably damaging	1.00
IGL01636:Dnttip2	APN	3	122282474	missense	possibly damaging	0.95
IGL01988:Dnttip2	APN	3	122276295	missense	probably benign	0.05
IGL02096:Dnttip2	APN	3	122284413	missense	possibly damaging	0.51
IGL02216:Dnttip2	APN	3	122276261	missense	probably benign	0.01
IGL03234:Dnttip2	APN	3	122282438	missense	probably damaging	1.00
Abyss	UTSW	3	122276221	missense	probably damaging	0.99
Chasm	UTSW	3	122275808	missense	probably damaging	1.00
R0089:Dnttip2	UTSW	3	122275462	missense	possibly damaging	0.59
R0102:Dnttip2	UTSW	3	122275803	missense	probably benign	0.00
R0102:Dnttip2	UTSW	3	122275803	missense	probably benign	0.00
R0195:Dnttip2	UTSW	3	122276161	missense	probably benign	0.02
R1103:Dnttip2	UTSW	3	122276422	missense	probably benign	0.02
R1733:Dnttip2	UTSW	3	122276748	missense	probably benign	0.25
R1759:Dnttip2	UTSW	3	122276149	missense	probably benign	0.21
R2019:Dnttip2	UTSW	3	122280744	missense	possibly damaging	0.93
R2022:Dnttip2	UTSW	3	122276221	missense	probably damaging	1.00
R2415:Dnttip2	UTSW	3	122276537	missense	probably damaging	1.00
R3913:Dnttip2	UTSW	3	122275391	missense	possibly damaging	0.68
R4194:Dnttip2	UTSW	3	122280761	missense	probably damaging	1.00
R4367:Dnttip2	UTSW	3	122276497	missense	probably damaging	1.00
R4871:Dnttip2	UTSW	3	122285101	missense	probably damaging	1.00
R4888:Dnttip2	UTSW	3	122276592	missense	probably damaging	1.00
R5436:Dnttip2	UTSW	3	122278769	missense	probably damaging	1.00
R5483:Dnttip2	UTSW	3	122276797	missense	probably damaging	0.97
R5933:Dnttip2	UTSW	3	122275568	missense	probably benign	0.07
R5966:Dnttip2	UTSW	3	122285168	utr 3 prime	probably benign
R6171:Dnttip2	UTSW	3	122278862	missense	probably damaging	0.99
R6251:Dnttip2	UTSW	3	122275256	missense	probably benign	0.14
R6286:Dnttip2	UTSW	3	122284400	missense	probably damaging	1.00
R6512:Dnttip2	UTSW	3	122275523	missense	possibly damaging	0.67
R6519:Dnttip2	UTSW	3	122275471	missense	probably benign	0.05
R6670:Dnttip2	UTSW	3	122276221	missense	probably damaging	0.99
R6833:Dnttip2	UTSW	3	122276803	missense	probably damaging	0.99
R6870:Dnttip2	UTSW	3	122275808	missense	probably damaging	1.00
R6969:Dnttip2	UTSW	3	122282492	missense	probably damaging	1.00
R7038:Dnttip2	UTSW	3	122276532	nonsense	probably null
R7233:Dnttip2	UTSW	3	122276390	missense	probably benign	0.26
R7423:Dnttip2	UTSW	3	122275526	missense	probably benign
R7591:Dnttip2	UTSW	3	122276468	nonsense	probably null
R7765:Dnttip2	UTSW	3	122275945	missense	probably benign	0.09
R7842:Dnttip2	UTSW	3	122276341	missense	probably benign	0.03
R7899:Dnttip2	UTSW	3	122282369	missense	probably damaging	1.00
R8408:Dnttip2	UTSW	3	122276702	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTGCCGAGAACAACAGCC -3'
(R):5'- AAAGACTCCGCTGGGAATC -3'

Sequencing Primer
(F):5'- GAAATTACAGTTCCCAGCTGAG -3'
(R):5'- GACTCCGCTGGGAATCTTTCTC -3'

Posted On

2016-06-06