Incidental Mutation 'R5082:Dnttip2'
ID387178
Institutional Source Beutler Lab
Gene Symbol Dnttip2
Ensembl Gene ENSMUSG00000039756
Gene Namedeoxynucleotidyltransferase, terminal, interacting protein 2
Synonyms4930588M11Rik
MMRRC Submission 042671-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R5082 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location122274388-122285271 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 122275941 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 268 (K268N)
Ref Sequence ENSEMBL: ENSMUSP00000045043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035776]
Predicted Effect probably damaging
Transcript: ENSMUST00000035776
AA Change: K268N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045043
Gene: ENSMUSG00000039756
AA Change: K268N

DomainStartEndE-ValueType
low complexity region 125 143 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
coiled coil region 513 541 N/A INTRINSIC
low complexity region 550 565 N/A INTRINSIC
Pfam:Fcf2 639 733 3.4e-41 PFAM
low complexity region 748 756 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000072769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199627
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be involved in chromatin remodeling and gene transcription. The encoded nuclear protein binds to and enhances the transcriptional activity of the estrogen receptor alpha, and also interacts with terminal deoxynucleotidyltransferase. The expression profile of this gene is a potential biomarker for chronic obstructive pulmonary disease. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,131,868 M1015L probably benign Het
Aftph T C 11: 20,727,100 S170G probably damaging Het
Aox4 C T 1: 58,231,483 P274S possibly damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
Aspm T A 1: 139,478,676 L1767* probably null Het
Baz2b T A 2: 59,901,491 K2068* probably null Het
Bcl9 A T 3: 97,209,902 V492D probably damaging Het
Bicc1 G T 10: 70,940,522 H782Q probably benign Het
Cabin1 T A 10: 75,738,330 I640F probably damaging Het
Ccng1 A G 11: 40,752,188 V144A possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ddx1 G T 12: 13,220,435 C668* probably null Het
Dhx58 G A 11: 100,696,976 S585L probably benign Het
Ecd C T 14: 20,324,368 probably null Het
Entpd1 A G 19: 40,725,029 probably null Het
Erlin2 T C 8: 27,033,407 V224A probably damaging Het
Exoc3l4 A G 12: 111,427,990 S515G probably benign Het
Fcho1 T C 8: 71,717,185 D98G possibly damaging Het
Fhod1 T A 8: 105,330,513 D943V probably damaging Het
Gm10322 A T 10: 59,616,268 E69V possibly damaging Het
Gm14295 T A 2: 176,807,417 L19* probably null Het
Gm7347 T A 5: 26,057,374 R50* probably null Het
Hesx1 T C 14: 27,000,774 C19R probably benign Het
Hgh1 T A 15: 76,369,552 F199L probably benign Het
Irak2 T C 6: 113,672,844 F147L probably damaging Het
Kif22 G A 7: 127,033,377 R254C possibly damaging Het
Klhl9 A T 4: 88,721,385 S206R probably damaging Het
Maip1 T C 1: 57,411,851 probably null Het
Mcm9 T A 10: 53,538,060 E308V possibly damaging Het
Mfsd13b A T 7: 120,998,978 N369I possibly damaging Het
Mga T A 2: 119,903,344 H224Q probably damaging Het
Mtss1 A T 15: 58,971,019 W115R probably damaging Het
Myo3b T C 2: 70,258,030 V851A probably benign Het
Nectin2 A T 7: 19,738,124 D113E probably damaging Het
Notch2 G A 3: 98,100,374 C480Y probably damaging Het
Olfr711 G A 7: 106,971,664 R227C probably benign Het
Olfr922 T C 9: 38,816,145 I214T possibly damaging Het
Pfdn1 G T 18: 36,404,413 N111K probably damaging Het
Pfkl A T 10: 77,996,408 V283E probably damaging Het
Plbd2 G T 5: 120,491,184 S305* probably null Het
Prom1 T C 5: 44,000,832 probably null Het
Ptbp2 T A 3: 119,752,964 M90L probably benign Het
Rai1 G A 11: 60,185,919 E270K possibly damaging Het
Rbbp6 G A 7: 123,000,702 probably benign Het
Reln T C 5: 21,896,077 M3399V probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sh2d2a A G 3: 87,851,784 D231G probably benign Het
Smn1 T C 13: 100,137,382 probably benign Het
Snrnp200 C T 2: 127,226,370 Q877* probably null Het
Taf2 G T 15: 55,060,045 H279N probably benign Het
Tnfaip3 T C 10: 19,005,284 Y345C probably damaging Het
Vmn2r68 C T 7: 85,233,868 M225I probably benign Het
Vps13a A T 19: 16,744,893 W352R probably damaging Het
Other mutations in Dnttip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Dnttip2 APN 3 122284499 missense probably damaging 1.00
IGL00921:Dnttip2 APN 3 122275290 missense probably benign 0.03
IGL01120:Dnttip2 APN 3 122278737 splice site probably benign
IGL01341:Dnttip2 APN 3 122276612 missense probably damaging 1.00
IGL01636:Dnttip2 APN 3 122282474 missense possibly damaging 0.95
IGL01988:Dnttip2 APN 3 122276295 missense probably benign 0.05
IGL02096:Dnttip2 APN 3 122284413 missense possibly damaging 0.51
IGL02216:Dnttip2 APN 3 122276261 missense probably benign 0.01
IGL03234:Dnttip2 APN 3 122282438 missense probably damaging 1.00
Abyss UTSW 3 122276221 missense probably damaging 0.99
Chasm UTSW 3 122275808 missense probably damaging 1.00
R0089:Dnttip2 UTSW 3 122275462 missense possibly damaging 0.59
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0102:Dnttip2 UTSW 3 122275803 missense probably benign 0.00
R0195:Dnttip2 UTSW 3 122276161 missense probably benign 0.02
R1103:Dnttip2 UTSW 3 122276422 missense probably benign 0.02
R1733:Dnttip2 UTSW 3 122276748 missense probably benign 0.25
R1759:Dnttip2 UTSW 3 122276149 missense probably benign 0.21
R2019:Dnttip2 UTSW 3 122280744 missense possibly damaging 0.93
R2022:Dnttip2 UTSW 3 122276221 missense probably damaging 1.00
R2415:Dnttip2 UTSW 3 122276537 missense probably damaging 1.00
R3913:Dnttip2 UTSW 3 122275391 missense possibly damaging 0.68
R4194:Dnttip2 UTSW 3 122280761 missense probably damaging 1.00
R4367:Dnttip2 UTSW 3 122276497 missense probably damaging 1.00
R4871:Dnttip2 UTSW 3 122285101 missense probably damaging 1.00
R4888:Dnttip2 UTSW 3 122276592 missense probably damaging 1.00
R5436:Dnttip2 UTSW 3 122278769 missense probably damaging 1.00
R5483:Dnttip2 UTSW 3 122276797 missense probably damaging 0.97
R5933:Dnttip2 UTSW 3 122275568 missense probably benign 0.07
R5966:Dnttip2 UTSW 3 122285168 utr 3 prime probably benign
R6171:Dnttip2 UTSW 3 122278862 missense probably damaging 0.99
R6251:Dnttip2 UTSW 3 122275256 missense probably benign 0.14
R6286:Dnttip2 UTSW 3 122284400 missense probably damaging 1.00
R6512:Dnttip2 UTSW 3 122275523 missense possibly damaging 0.67
R6519:Dnttip2 UTSW 3 122275471 missense probably benign 0.05
R6670:Dnttip2 UTSW 3 122276221 missense probably damaging 0.99
R6833:Dnttip2 UTSW 3 122276803 missense probably damaging 0.99
R6870:Dnttip2 UTSW 3 122275808 missense probably damaging 1.00
R6969:Dnttip2 UTSW 3 122282492 missense probably damaging 1.00
R7038:Dnttip2 UTSW 3 122276532 nonsense probably null
R7233:Dnttip2 UTSW 3 122276390 missense probably benign 0.26
R7423:Dnttip2 UTSW 3 122275526 missense probably benign
R7591:Dnttip2 UTSW 3 122276468 nonsense probably null
R7765:Dnttip2 UTSW 3 122275945 missense probably benign 0.09
R7842:Dnttip2 UTSW 3 122276341 missense probably benign 0.03
R7899:Dnttip2 UTSW 3 122282369 missense probably damaging 1.00
R8408:Dnttip2 UTSW 3 122276702 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGCCGAGAACAACAGCC -3'
(R):5'- AAAGACTCCGCTGGGAATC -3'

Sequencing Primer
(F):5'- GAAATTACAGTTCCCAGCTGAG -3'
(R):5'- GACTCCGCTGGGAATCTTTCTC -3'
Posted On2016-06-06