Mutagenetix > Incidental Mutation

Incidental Mutation 'R5082:Vmn2r68'

387188

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r68

Ensembl Gene

ENSMUSG00000096861

Gene Name

vomeronasal 2, receptor 68

Synonyms

Vmn2r68-ps, EG620697

MMRRC Submission

042671-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.077) question?

Stock #

R5082 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85221518-85237704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85233868 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 225 (M225I)

Ref Sequence

ENSEMBL: ENSMUSP00000129411 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061074]

AlphaFold

L7N2B3

Predicted Effect

probably benign
Transcript: ENSMUST00000061074
AA Change: M225I

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M225I

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	463	4.5e-28	PFAM
Pfam:NCD3G	507	559	1.1e-18	PFAM
Pfam:7tm_3	589	827	3.7e-53	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	A	11: 110,131,868	M1015L	probably benign	Het
Aftph	T	C	11: 20,727,100	S170G	probably damaging	Het
Aox4	C	T	1: 58,231,483	P274S	possibly damaging	Het
Ash1l	G	A	3: 88,966,234	R108Q	probably damaging	Het
Aspm	T	A	1: 139,478,676	L1767*	probably null	Het
Baz2b	T	A	2: 59,901,491	K2068*	probably null	Het
Bcl9	A	T	3: 97,209,902	V492D	probably damaging	Het
Bicc1	G	T	10: 70,940,522	H782Q	probably benign	Het
Cabin1	T	A	10: 75,738,330	I640F	probably damaging	Het
Ccng1	A	G	11: 40,752,188	V144A	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Ddx1	G	T	12: 13,220,435	C668*	probably null	Het
Dhx58	G	A	11: 100,696,976	S585L	probably benign	Het
Dnttip2	A	T	3: 122,275,941	K268N	probably damaging	Het
Ecd	C	T	14: 20,324,368		probably null	Het
Entpd1	A	G	19: 40,725,029		probably null	Het
Erlin2	T	C	8: 27,033,407	V224A	probably damaging	Het
Exoc3l4	A	G	12: 111,427,990	S515G	probably benign	Het
Fcho1	T	C	8: 71,717,185	D98G	possibly damaging	Het
Fhod1	T	A	8: 105,330,513	D943V	probably damaging	Het
Gm10322	A	T	10: 59,616,268	E69V	possibly damaging	Het
Gm14295	T	A	2: 176,807,417	L19*	probably null	Het
Gm7347	T	A	5: 26,057,374	R50*	probably null	Het
Hesx1	T	C	14: 27,000,774	C19R	probably benign	Het
Hgh1	T	A	15: 76,369,552	F199L	probably benign	Het
Irak2	T	C	6: 113,672,844	F147L	probably damaging	Het
Kif22	G	A	7: 127,033,377	R254C	possibly damaging	Het
Klhl9	A	T	4: 88,721,385	S206R	probably damaging	Het
Maip1	T	C	1: 57,411,851		probably null	Het
Mcm9	T	A	10: 53,538,060	E308V	possibly damaging	Het
Mfsd13b	A	T	7: 120,998,978	N369I	possibly damaging	Het
Mga	T	A	2: 119,903,344	H224Q	probably damaging	Het
Mtss1	A	T	15: 58,971,019	W115R	probably damaging	Het
Myo3b	T	C	2: 70,258,030	V851A	probably benign	Het
Nectin2	A	T	7: 19,738,124	D113E	probably damaging	Het
Notch2	G	A	3: 98,100,374	C480Y	probably damaging	Het
Olfr711	G	A	7: 106,971,664	R227C	probably benign	Het
Olfr922	T	C	9: 38,816,145	I214T	possibly damaging	Het
Pfdn1	G	T	18: 36,404,413	N111K	probably damaging	Het
Pfkl	A	T	10: 77,996,408	V283E	probably damaging	Het
Plbd2	G	T	5: 120,491,184	S305*	probably null	Het
Prom1	T	C	5: 44,000,832		probably null	Het
Ptbp2	T	A	3: 119,752,964	M90L	probably benign	Het
Rai1	G	A	11: 60,185,919	E270K	possibly damaging	Het
Rbbp6	G	A	7: 123,000,702		probably benign	Het
Reln	T	C	5: 21,896,077	M3399V	probably benign	Het
Ros1	T	A	10: 52,163,941	Y318F	possibly damaging	Het
Sh2d2a	A	G	3: 87,851,784	D231G	probably benign	Het
Smn1	T	C	13: 100,137,382		probably benign	Het
Snrnp200	C	T	2: 127,226,370	Q877*	probably null	Het
Taf2	G	T	15: 55,060,045	H279N	probably benign	Het
Tnfaip3	T	C	10: 19,005,284	Y345C	probably damaging	Het
Vps13a	A	T	19: 16,744,893	W352R	probably damaging	Het

Other mutations in Vmn2r68

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01391:Vmn2r68	APN	7	85237611	missense	probably benign
IGL01477:Vmn2r68	APN	7	85233483	missense	probably damaging	1.00
IGL01600:Vmn2r68	APN	7	85222260	missense	probably benign	0.39
IGL01979:Vmn2r68	APN	7	85222117	missense	probably benign
IGL01999:Vmn2r68	APN	7	85222231	missense	probably damaging	1.00
IGL02269:Vmn2r68	APN	7	85221739	missense	possibly damaging	0.84
IGL02517:Vmn2r68	APN	7	85221945	nonsense	probably null
IGL02827:Vmn2r68	APN	7	85237592	missense	probably damaging	1.00
IGL02852:Vmn2r68	APN	7	85233387	missense	probably damaging	1.00
IGL02982:Vmn2r68	APN	7	85234441	missense	probably benign	0.12
IGL03099:Vmn2r68	APN	7	85222240	nonsense	probably null
IGL03166:Vmn2r68	APN	7	85222123	missense	probably benign	0.01
IGL03168:Vmn2r68	APN	7	85221764	missense	probably damaging	1.00
IGL03243:Vmn2r68	APN	7	85233755	missense	possibly damaging	0.66
F5770:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
R0280:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0280:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0281:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0281:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0348:Vmn2r68	UTSW	7	85221676	missense	possibly damaging	0.50
R0390:Vmn2r68	UTSW	7	85233249	splice site	probably benign
R0390:Vmn2r68	UTSW	7	85233258	critical splice donor site	probably null
R0722:Vmn2r68	UTSW	7	85221586	missense	possibly damaging	0.95
R1129:Vmn2r68	UTSW	7	85237504	splice site	probably null
R1136:Vmn2r68	UTSW	7	85222341	missense	possibly damaging	0.81
R1319:Vmn2r68	UTSW	7	85232492	missense	probably damaging	0.96
R1614:Vmn2r68	UTSW	7	85221738	missense	possibly damaging	0.93
R1682:Vmn2r68	UTSW	7	85233366	missense	possibly damaging	0.68
R1837:Vmn2r68	UTSW	7	85233678	missense	probably damaging	0.96
R1893:Vmn2r68	UTSW	7	85234659	nonsense	probably null
R1908:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1909:Vmn2r68	UTSW	7	85234052	missense	probably benign	0.09
R1951:Vmn2r68	UTSW	7	85233894	missense	probably damaging	1.00
R2177:Vmn2r68	UTSW	7	85221915	missense	probably benign	0.01
R2178:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2185:Vmn2r68	UTSW	7	85233693	nonsense	probably null
R2188:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R2282:Vmn2r68	UTSW	7	85221651	missense	possibly damaging	0.65
R2567:Vmn2r68	UTSW	7	85234595	missense	probably benign
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2869:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2870:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2871:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2873:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R2874:Vmn2r68	UTSW	7	85233626	missense	probably benign	0.25
R3149:Vmn2r68	UTSW	7	85237667	missense	probably benign	0.00
R3401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R3978:Vmn2r68	UTSW	7	85232462	missense	probably benign	0.00
R4399:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4401:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4421:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4478:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4479:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4495:Vmn2r68	UTSW	7	85221550	frame shift	probably null
R4628:Vmn2r68	UTSW	7	85234465	missense	probably benign	0.00
R4649:Vmn2r68	UTSW	7	85221535	missense	probably benign
R4654:Vmn2r68	UTSW	7	85233561	nonsense	probably null
R4793:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R5007:Vmn2r68	UTSW	7	85232414	missense	probably benign
R5021:Vmn2r68	UTSW	7	85233734	missense	possibly damaging	0.62
R5177:Vmn2r68	UTSW	7	85221991	missense	probably damaging	0.99
R5221:Vmn2r68	UTSW	7	85221877	missense	probably damaging	1.00
R5514:Vmn2r68	UTSW	7	85237559	missense	possibly damaging	0.92
R5521:Vmn2r68	UTSW	7	85233718	missense	probably benign	0.03
R5563:Vmn2r68	UTSW	7	85222075	missense	probably damaging	1.00
R5664:Vmn2r68	UTSW	7	85233770	missense	probably benign	0.02
R5829:Vmn2r68	UTSW	7	85237604	missense	probably benign	0.00
R6016:Vmn2r68	UTSW	7	85222245	missense	probably damaging	0.99
R6356:Vmn2r68	UTSW	7	85233840	missense	possibly damaging	0.85
R6413:Vmn2r68	UTSW	7	85221765	missense	probably damaging	1.00
R6418:Vmn2r68	UTSW	7	85233707	missense	probably benign
R6699:Vmn2r68	UTSW	7	85232375	missense	possibly damaging	0.58
R7287:Vmn2r68	UTSW	7	85222252	missense	probably benign	0.33
R7319:Vmn2r68	UTSW	7	85233834	missense	probably benign
R7374:Vmn2r68	UTSW	7	85232399	missense	possibly damaging	0.66
R7585:Vmn2r68	UTSW	7	85232379	missense	probably damaging	1.00
R7605:Vmn2r68	UTSW	7	85233908	missense	probably benign	0.01
R7892:Vmn2r68	UTSW	7	85234514	missense	probably benign
R7979:Vmn2r68	UTSW	7	85234417	critical splice donor site	probably null
R8177:Vmn2r68	UTSW	7	85222214	nonsense	probably null
R8349:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8378:Vmn2r68	UTSW	7	85221900	missense	probably benign	0.00
R8397:Vmn2r68	UTSW	7	85237514	missense	possibly damaging	0.71
R8449:Vmn2r68	UTSW	7	85233577	missense	probably damaging	1.00
R8543:Vmn2r68	UTSW	7	85234440	missense	probably benign	0.01
R8680:Vmn2r68	UTSW	7	85222113	missense	possibly damaging	0.68
R9056:Vmn2r68	UTSW	7	85222212	missense	possibly damaging	0.71
R9342:Vmn2r68	UTSW	7	85233785	missense	probably benign	0.39
R9734:Vmn2r68	UTSW	7	85233549	missense	possibly damaging	0.54
V7581:Vmn2r68	UTSW	7	85221880	missense	probably benign	0.01
Z1176:Vmn2r68	UTSW	7	85221733	missense	probably damaging	1.00
Z1176:Vmn2r68	UTSW	7	85222081	missense	probably benign	0.27
Z1176:Vmn2r68	UTSW	7	85222099	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- GCCTTTGGATTTACACAAATGGAG -3'
(R):5'- ACACACTCTACATCATTGCCTATG -3'

Sequencing Primer
(F):5'- TTTACACAAATGGAGGACAAGATC -3'
(R):5'- AGCTTTACTGCGGTCATTTTC -3'

Posted On

2016-06-06