Incidental Mutation 'R5082:Olfr711'
ID 387189
Institutional Source Beutler Lab
Gene Symbol Olfr711
Ensembl Gene ENSMUSG00000045013
Gene Name olfactory receptor 711
Synonyms GA_x6K02T2PBJ9-9352783-9351839, MOR103-4
MMRRC Submission 042671-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R5082 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 106969694-106975453 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 106971664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 227 (R227C)
Ref Sequence ENSEMBL: ENSMUSP00000149016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051715] [ENSMUST00000207200] [ENSMUST00000216335]
AlphaFold Q9EPG2
Predicted Effect probably benign
Transcript: ENSMUST00000051715
AA Change: R227C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000055724
Gene: ENSMUSG00000045013
AA Change: R227C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-58 PFAM
Pfam:7tm_1 41 290 1.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207200
AA Change: R227C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000216335
AA Change: R227C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,131,868 M1015L probably benign Het
Aftph T C 11: 20,727,100 S170G probably damaging Het
Aox4 C T 1: 58,231,483 P274S possibly damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
Aspm T A 1: 139,478,676 L1767* probably null Het
Baz2b T A 2: 59,901,491 K2068* probably null Het
Bcl9 A T 3: 97,209,902 V492D probably damaging Het
Bicc1 G T 10: 70,940,522 H782Q probably benign Het
Cabin1 T A 10: 75,738,330 I640F probably damaging Het
Ccng1 A G 11: 40,752,188 V144A possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ddx1 G T 12: 13,220,435 C668* probably null Het
Dhx58 G A 11: 100,696,976 S585L probably benign Het
Dnttip2 A T 3: 122,275,941 K268N probably damaging Het
Ecd C T 14: 20,324,368 probably null Het
Entpd1 A G 19: 40,725,029 probably null Het
Erlin2 T C 8: 27,033,407 V224A probably damaging Het
Exoc3l4 A G 12: 111,427,990 S515G probably benign Het
Fcho1 T C 8: 71,717,185 D98G possibly damaging Het
Fhod1 T A 8: 105,330,513 D943V probably damaging Het
Gm10322 A T 10: 59,616,268 E69V possibly damaging Het
Gm14295 T A 2: 176,807,417 L19* probably null Het
Gm7347 T A 5: 26,057,374 R50* probably null Het
Hesx1 T C 14: 27,000,774 C19R probably benign Het
Hgh1 T A 15: 76,369,552 F199L probably benign Het
Irak2 T C 6: 113,672,844 F147L probably damaging Het
Kif22 G A 7: 127,033,377 R254C possibly damaging Het
Klhl9 A T 4: 88,721,385 S206R probably damaging Het
Maip1 T C 1: 57,411,851 probably null Het
Mcm9 T A 10: 53,538,060 E308V possibly damaging Het
Mfsd13b A T 7: 120,998,978 N369I possibly damaging Het
Mga T A 2: 119,903,344 H224Q probably damaging Het
Mtss1 A T 15: 58,971,019 W115R probably damaging Het
Myo3b T C 2: 70,258,030 V851A probably benign Het
Nectin2 A T 7: 19,738,124 D113E probably damaging Het
Notch2 G A 3: 98,100,374 C480Y probably damaging Het
Olfr922 T C 9: 38,816,145 I214T possibly damaging Het
Pfdn1 G T 18: 36,404,413 N111K probably damaging Het
Pfkl A T 10: 77,996,408 V283E probably damaging Het
Plbd2 G T 5: 120,491,184 S305* probably null Het
Prom1 T C 5: 44,000,832 probably null Het
Ptbp2 T A 3: 119,752,964 M90L probably benign Het
Rai1 G A 11: 60,185,919 E270K possibly damaging Het
Rbbp6 G A 7: 123,000,702 probably benign Het
Reln T C 5: 21,896,077 M3399V probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sh2d2a A G 3: 87,851,784 D231G probably benign Het
Smn1 T C 13: 100,137,382 probably benign Het
Snrnp200 C T 2: 127,226,370 Q877* probably null Het
Taf2 G T 15: 55,060,045 H279N probably benign Het
Tnfaip3 T C 10: 19,005,284 Y345C probably damaging Het
Vmn2r68 C T 7: 85,233,868 M225I probably benign Het
Vps13a A T 19: 16,744,893 W352R probably damaging Het
Other mutations in Olfr711
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02600:Olfr711 APN 7 106971549 missense possibly damaging 0.51
R0087:Olfr711 UTSW 7 106972116 missense probably benign 0.01
R0580:Olfr711 UTSW 7 106972240 missense probably damaging 1.00
R1375:Olfr711 UTSW 7 106972098 missense probably damaging 1.00
R1538:Olfr711 UTSW 7 106971983 nonsense probably null
R1875:Olfr711 UTSW 7 106972182 missense possibly damaging 0.86
R2156:Olfr711 UTSW 7 106971568 missense probably damaging 1.00
R4290:Olfr711 UTSW 7 106971711 missense probably damaging 0.97
R4332:Olfr711 UTSW 7 106972147 missense probably benign 0.00
R4400:Olfr711 UTSW 7 106972002 missense probably damaging 1.00
R4688:Olfr711 UTSW 7 106971861 missense probably benign 0.02
R4868:Olfr711 UTSW 7 106971767 missense probably benign
R4970:Olfr711 UTSW 7 106971571 missense probably benign 0.35
R5006:Olfr711 UTSW 7 106971601 missense probably damaging 1.00
R5121:Olfr711 UTSW 7 106972231 missense probably benign
R6465:Olfr711 UTSW 7 106972212 missense possibly damaging 0.63
R6541:Olfr711 UTSW 7 106972203 missense probably benign 0.20
R7419:Olfr711 UTSW 7 106972146 missense probably benign 0.01
R8048:Olfr711 UTSW 7 106972464 start gained probably benign
R9310:Olfr711 UTSW 7 106971471 missense probably damaging 1.00
R9470:Olfr711 UTSW 7 106972254 missense probably benign 0.26
R9603:Olfr711 UTSW 7 106971896 nonsense probably null
Z1177:Olfr711 UTSW 7 106971915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTGCATCCTTGACTTCCCGG -3'
(R):5'- TTCTGTGGCTCCAATGTCATG -3'

Sequencing Primer
(F):5'- CCGGTTCCTTAGGCAGTAGATGAAG -3'
(R):5'- GTGGCTCCAATGTCATGAACCAC -3'
Posted On 2016-06-06