Incidental Mutation 'R5082:Bicc1'
ID387202
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 042671-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5082 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70940522 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 782 (H782Q)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably benign
Transcript: ENSMUST00000014473
AA Change: H782Q

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: H782Q

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131445
AA Change: H700Q

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: H700Q

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143791
AA Change: H782Q

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: H782Q

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,131,868 M1015L probably benign Het
Aftph T C 11: 20,727,100 S170G probably damaging Het
Aox4 C T 1: 58,231,483 P274S possibly damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
Aspm T A 1: 139,478,676 L1767* probably null Het
Baz2b T A 2: 59,901,491 K2068* probably null Het
Bcl9 A T 3: 97,209,902 V492D probably damaging Het
Cabin1 T A 10: 75,738,330 I640F probably damaging Het
Ccng1 A G 11: 40,752,188 V144A possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ddx1 G T 12: 13,220,435 C668* probably null Het
Dhx58 G A 11: 100,696,976 S585L probably benign Het
Dnttip2 A T 3: 122,275,941 K268N probably damaging Het
Ecd C T 14: 20,324,368 probably null Het
Entpd1 A G 19: 40,725,029 probably null Het
Erlin2 T C 8: 27,033,407 V224A probably damaging Het
Exoc3l4 A G 12: 111,427,990 S515G probably benign Het
Fcho1 T C 8: 71,717,185 D98G possibly damaging Het
Fhod1 T A 8: 105,330,513 D943V probably damaging Het
Gm10322 A T 10: 59,616,268 E69V possibly damaging Het
Gm14295 T A 2: 176,807,417 L19* probably null Het
Gm7347 T A 5: 26,057,374 R50* probably null Het
Hesx1 T C 14: 27,000,774 C19R probably benign Het
Hgh1 T A 15: 76,369,552 F199L probably benign Het
Irak2 T C 6: 113,672,844 F147L probably damaging Het
Kif22 G A 7: 127,033,377 R254C possibly damaging Het
Klhl9 A T 4: 88,721,385 S206R probably damaging Het
Maip1 T C 1: 57,411,851 probably null Het
Mcm9 T A 10: 53,538,060 E308V possibly damaging Het
Mfsd13b A T 7: 120,998,978 N369I possibly damaging Het
Mga T A 2: 119,903,344 H224Q probably damaging Het
Mtss1 A T 15: 58,971,019 W115R probably damaging Het
Myo3b T C 2: 70,258,030 V851A probably benign Het
Nectin2 A T 7: 19,738,124 D113E probably damaging Het
Notch2 G A 3: 98,100,374 C480Y probably damaging Het
Olfr711 G A 7: 106,971,664 R227C probably benign Het
Olfr922 T C 9: 38,816,145 I214T possibly damaging Het
Pfdn1 G T 18: 36,404,413 N111K probably damaging Het
Pfkl A T 10: 77,996,408 V283E probably damaging Het
Plbd2 G T 5: 120,491,184 S305* probably null Het
Prom1 T C 5: 44,000,832 probably null Het
Ptbp2 T A 3: 119,752,964 M90L probably benign Het
Rai1 G A 11: 60,185,919 E270K possibly damaging Het
Rbbp6 G A 7: 123,000,702 probably benign Het
Reln T C 5: 21,896,077 M3399V probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sh2d2a A G 3: 87,851,784 D231G probably benign Het
Smn1 T C 13: 100,137,382 probably benign Het
Snrnp200 C T 2: 127,226,370 Q877* probably null Het
Taf2 G T 15: 55,060,045 H279N probably benign Het
Tnfaip3 T C 10: 19,005,284 Y345C probably damaging Het
Vmn2r68 C T 7: 85,233,868 M225I probably benign Het
Vps13a A T 19: 16,744,893 W352R probably damaging Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1678:Bicc1 UTSW 10 70943518 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
R7021:Bicc1 UTSW 10 70961148 missense probably damaging 0.99
R7101:Bicc1 UTSW 10 70930653 missense probably damaging 1.00
R7351:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7352:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7353:Bicc1 UTSW 10 70947900 missense probably benign 0.18
R7366:Bicc1 UTSW 10 70943386 missense probably benign 0.01
R7480:Bicc1 UTSW 10 70943476 missense probably damaging 1.00
R7541:Bicc1 UTSW 10 70946604 missense possibly damaging 0.82
R7544:Bicc1 UTSW 10 70956374 missense possibly damaging 0.89
R7555:Bicc1 UTSW 10 70956291 missense possibly damaging 0.75
R7663:Bicc1 UTSW 10 70946590 missense probably benign
R7671:Bicc1 UTSW 10 70957167 missense probably benign 0.01
R7747:Bicc1 UTSW 10 70946993 missense probably benign
RF013:Bicc1 UTSW 10 70935830 critical splice donor site probably null
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTGCAGCTGCTCTTTGC -3'
(R):5'- AGAATGAAGAAACCTTGTTCCCC -3'

Sequencing Primer
(F):5'- ACCCCACTTTATCATGTAGGATAC -3'
(R):5'- TGAAGAAACCTTGTTCCCCCTCAG -3'
Posted On2016-06-06