Mutagenetix > Incidental Mutation

Incidental Mutation 'R5082:Cabin1'

387203

Institutional Source

Beutler Lab

Gene Symbol

Cabin1

Ensembl Gene

ENSMUSG00000020196

Gene Name

calcineurin binding protein 1

Synonyms

Cain, Ppp3in, A330070M20Rik

MMRRC Submission

042671-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5082 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75646112-75764341 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75738330 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 640 (I640F)

Ref Sequence

ENSEMBL: ENSMUSP00000001712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001712]

AlphaFold

G3X8Q1

Predicted Effect

probably damaging
Transcript: ENSMUST00000001712
AA Change: I640F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: I640F

Domain	Start	End	E-Value	Type
low complexity region	61	71	N/A	INTRINSIC
TPR	90	123	4.15e-2	SMART
TPR	124	157	5.69e0	SMART
low complexity region	312	326	N/A	INTRINSIC
low complexity region	365	381	N/A	INTRINSIC
TPR	615	648	9.7e0	SMART
low complexity region	740	750	N/A	INTRINSIC
low complexity region	882	892	N/A	INTRINSIC
TPR	1055	1088	6.92e1	SMART
low complexity region	1327	1349	N/A	INTRINSIC
low complexity region	1714	1727	N/A	INTRINSIC
low complexity region	1778	1790	N/A	INTRINSIC
low complexity region	1791	1803	N/A	INTRINSIC
low complexity region	1810	1831	N/A	INTRINSIC
low complexity region	1941	1956	N/A	INTRINSIC
Pfam:MEF2_binding	2123	2157	5.7e-26	PFAM
low complexity region	2165	2183	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217810

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	T	A	11: 110,131,868	M1015L	probably benign	Het
Aftph	T	C	11: 20,727,100	S170G	probably damaging	Het
Aox4	C	T	1: 58,231,483	P274S	possibly damaging	Het
Ash1l	G	A	3: 88,966,234	R108Q	probably damaging	Het
Aspm	T	A	1: 139,478,676	L1767*	probably null	Het
Baz2b	T	A	2: 59,901,491	K2068*	probably null	Het
Bcl9	A	T	3: 97,209,902	V492D	probably damaging	Het
Bicc1	G	T	10: 70,940,522	H782Q	probably benign	Het
Ccng1	A	G	11: 40,752,188	V144A	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Ddx1	G	T	12: 13,220,435	C668*	probably null	Het
Dhx58	G	A	11: 100,696,976	S585L	probably benign	Het
Dnttip2	A	T	3: 122,275,941	K268N	probably damaging	Het
Ecd	C	T	14: 20,324,368		probably null	Het
Entpd1	A	G	19: 40,725,029		probably null	Het
Erlin2	T	C	8: 27,033,407	V224A	probably damaging	Het
Exoc3l4	A	G	12: 111,427,990	S515G	probably benign	Het
Fcho1	T	C	8: 71,717,185	D98G	possibly damaging	Het
Fhod1	T	A	8: 105,330,513	D943V	probably damaging	Het
Gm10322	A	T	10: 59,616,268	E69V	possibly damaging	Het
Gm14295	T	A	2: 176,807,417	L19*	probably null	Het
Gm7347	T	A	5: 26,057,374	R50*	probably null	Het
Hesx1	T	C	14: 27,000,774	C19R	probably benign	Het
Hgh1	T	A	15: 76,369,552	F199L	probably benign	Het
Irak2	T	C	6: 113,672,844	F147L	probably damaging	Het
Kif22	G	A	7: 127,033,377	R254C	possibly damaging	Het
Klhl9	A	T	4: 88,721,385	S206R	probably damaging	Het
Maip1	T	C	1: 57,411,851		probably null	Het
Mcm9	T	A	10: 53,538,060	E308V	possibly damaging	Het
Mfsd13b	A	T	7: 120,998,978	N369I	possibly damaging	Het
Mga	T	A	2: 119,903,344	H224Q	probably damaging	Het
Mtss1	A	T	15: 58,971,019	W115R	probably damaging	Het
Myo3b	T	C	2: 70,258,030	V851A	probably benign	Het
Nectin2	A	T	7: 19,738,124	D113E	probably damaging	Het
Notch2	G	A	3: 98,100,374	C480Y	probably damaging	Het
Olfr711	G	A	7: 106,971,664	R227C	probably benign	Het
Olfr922	T	C	9: 38,816,145	I214T	possibly damaging	Het
Pfdn1	G	T	18: 36,404,413	N111K	probably damaging	Het
Pfkl	A	T	10: 77,996,408	V283E	probably damaging	Het
Plbd2	G	T	5: 120,491,184	S305*	probably null	Het
Prom1	T	C	5: 44,000,832		probably null	Het
Ptbp2	T	A	3: 119,752,964	M90L	probably benign	Het
Rai1	G	A	11: 60,185,919	E270K	possibly damaging	Het
Rbbp6	G	A	7: 123,000,702		probably benign	Het
Reln	T	C	5: 21,896,077	M3399V	probably benign	Het
Ros1	T	A	10: 52,163,941	Y318F	possibly damaging	Het
Sh2d2a	A	G	3: 87,851,784	D231G	probably benign	Het
Smn1	T	C	13: 100,137,382		probably benign	Het
Snrnp200	C	T	2: 127,226,370	Q877*	probably null	Het
Taf2	G	T	15: 55,060,045	H279N	probably benign	Het
Tnfaip3	T	C	10: 19,005,284	Y345C	probably damaging	Het
Vmn2r68	C	T	7: 85,233,868	M225I	probably benign	Het
Vps13a	A	T	19: 16,744,893	W352R	probably damaging	Het

Other mutations in Cabin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01434:Cabin1	APN	10	75725586	missense	possibly damaging	0.58
IGL01457:Cabin1	APN	10	75742429	missense	probably damaging	0.96
IGL02217:Cabin1	APN	10	75700047	missense	possibly damaging	0.95
IGL02649:Cabin1	APN	10	75737418	missense	probably damaging	1.00
IGL02737:Cabin1	APN	10	75713585	missense	probably benign	0.09
IGL02792:Cabin1	APN	10	75746739	missense	probably damaging	1.00
IGL03047:Cabin1	APN	10	75700100	splice site	probably benign
IGL03106:Cabin1	APN	10	75733628	missense	probably benign	0.01
IGL03276:Cabin1	APN	10	75732413	missense	probably damaging	1.00
bison	UTSW	10	75684323	missense	probably damaging	1.00
range	UTSW	10	75658647	missense	probably damaging	1.00
R0335:Cabin1	UTSW	10	75657049	missense	probably damaging	1.00
R0557:Cabin1	UTSW	10	75726917	missense	probably damaging	1.00
R0578:Cabin1	UTSW	10	75713610	missense	probably damaging	0.96
R0588:Cabin1	UTSW	10	75745337	missense	possibly damaging	0.71
R1115:Cabin1	UTSW	10	75717677	missense	possibly damaging	0.70
R1120:Cabin1	UTSW	10	75725716	missense	probably damaging	1.00
R1439:Cabin1	UTSW	10	75656806	missense	probably damaging	1.00
R1471:Cabin1	UTSW	10	75694792	missense	probably damaging	1.00
R1794:Cabin1	UTSW	10	75725745	missense	possibly damaging	0.52
R1844:Cabin1	UTSW	10	75743350	splice site	probably null
R1959:Cabin1	UTSW	10	75735090	missense	possibly damaging	0.92
R2008:Cabin1	UTSW	10	75734976	splice site	probably null
R2279:Cabin1	UTSW	10	75753461	missense	probably benign
R3150:Cabin1	UTSW	10	75656911	missense	probably damaging	1.00
R3929:Cabin1	UTSW	10	75751618	critical splice acceptor site	probably null
R3945:Cabin1	UTSW	10	75745259	missense	probably damaging	1.00
R3946:Cabin1	UTSW	10	75745259	missense	probably damaging	1.00
R4206:Cabin1	UTSW	10	75754841	missense	possibly damaging	0.69
R4812:Cabin1	UTSW	10	75646594	missense	possibly damaging	0.93
R4944:Cabin1	UTSW	10	75721363	missense	probably damaging	1.00
R4944:Cabin1	UTSW	10	75739421	missense	probably damaging	0.99
R5078:Cabin1	UTSW	10	75721478	missense	probably damaging	1.00
R5319:Cabin1	UTSW	10	75725715	missense	probably damaging	1.00
R5481:Cabin1	UTSW	10	75735066	missense	probably benign	0.29
R5504:Cabin1	UTSW	10	75653009	missense	probably benign	0.00
R5710:Cabin1	UTSW	10	75647018	missense	probably benign	0.00
R5908:Cabin1	UTSW	10	75721532	missense	probably damaging	1.00
R5975:Cabin1	UTSW	10	75657839	missense	probably damaging	1.00
R5982:Cabin1	UTSW	10	75725560	missense	probably benign	0.00
R6038:Cabin1	UTSW	10	75739366	missense	probably benign	0.02
R6038:Cabin1	UTSW	10	75739366	missense	probably benign	0.02
R6114:Cabin1	UTSW	10	75747971	missense	probably benign	0.00
R6285:Cabin1	UTSW	10	75684323	missense	probably damaging	1.00
R6341:Cabin1	UTSW	10	75658739	missense	probably damaging	0.98
R6361:Cabin1	UTSW	10	75726865	missense	possibly damaging	0.91
R6395:Cabin1	UTSW	10	75746742	missense	probably benign	0.10
R6422:Cabin1	UTSW	10	75656792	missense	probably damaging	1.00
R6575:Cabin1	UTSW	10	75725701	missense	possibly damaging	0.90
R6763:Cabin1	UTSW	10	75746730	missense	probably damaging	0.99
R6845:Cabin1	UTSW	10	75721508	missense	probably damaging	1.00
R6936:Cabin1	UTSW	10	75715758	splice site	probably null
R7050:Cabin1	UTSW	10	75713542	missense	probably damaging	1.00
R7055:Cabin1	UTSW	10	75743283	missense	probably benign	0.04
R7101:Cabin1	UTSW	10	75751567	missense	probably benign
R7138:Cabin1	UTSW	10	75745353	missense	probably damaging	0.98
R7173:Cabin1	UTSW	10	75746562	missense	probably benign	0.00
R7265:Cabin1	UTSW	10	75721423	missense
R7284:Cabin1	UTSW	10	75694834	missense
R7472:Cabin1	UTSW	10	75658647	missense	probably damaging	1.00
R7571:Cabin1	UTSW	10	75646666	missense	probably damaging	1.00
R7617:Cabin1	UTSW	10	75732443	missense	possibly damaging	0.85
R7739:Cabin1	UTSW	10	75658658	missense	probably damaging	1.00
R7997:Cabin1	UTSW	10	75733775	missense	probably benign	0.01
R8347:Cabin1	UTSW	10	75742367	missense	probably damaging	0.98
R8544:Cabin1	UTSW	10	75750056	missense	probably benign	0.17
R8546:Cabin1	UTSW	10	75742267	missense	probably damaging	1.00
R8692:Cabin1	UTSW	10	75751576	missense	probably benign	0.28
R8839:Cabin1	UTSW	10	75656816	missense	probably benign	0.00
R9010:Cabin1	UTSW	10	75735058	nonsense	probably null
R9108:Cabin1	UTSW	10	75657139	missense	possibly damaging	0.94
R9204:Cabin1	UTSW	10	75694716	missense	probably benign	0.01
R9259:Cabin1	UTSW	10	75746742	missense	probably benign
R9312:Cabin1	UTSW	10	75725735	missense	probably benign	0.07
R9421:Cabin1	UTSW	10	75657824	missense	probably damaging	1.00
R9439:Cabin1	UTSW	10	75745235	missense	probably damaging	1.00
R9578:Cabin1	UTSW	10	75754351	missense	probably damaging	0.99
R9645:Cabin1	UTSW	10	75658709	missense	probably benign	0.36
R9649:Cabin1	UTSW	10	75739405	missense	probably damaging	0.98
R9711:Cabin1	UTSW	10	75743256	missense	probably benign	0.02
Z1177:Cabin1	UTSW	10	75648123	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CGTGGGCATCTCTTATTCCAGAG -3'
(R):5'- ACAAATATTTGGCTAGCCCCAC -3'

Sequencing Primer
(F):5'- GCATCTCTTATTCCAGAGGAGCAG -3'
(R):5'- GTCTGTAATCCTAGCACTCAGAGG -3'

Posted On

2016-06-06