Incidental Mutation 'R5082:Cabin1'
ID 387203
Institutional Source Beutler Lab
Gene Symbol Cabin1
Ensembl Gene ENSMUSG00000020196
Gene Name calcineurin binding protein 1
Synonyms Cain, Ppp3in, A330070M20Rik
MMRRC Submission 042671-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5082 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 75646112-75764341 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 75738330 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 640 (I640F)
Ref Sequence ENSEMBL: ENSMUSP00000001712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001712]
AlphaFold G3X8Q1
Predicted Effect probably damaging
Transcript: ENSMUST00000001712
AA Change: I640F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001712
Gene: ENSMUSG00000020196
AA Change: I640F

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
TPR 90 123 4.15e-2 SMART
TPR 124 157 5.69e0 SMART
low complexity region 312 326 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
TPR 615 648 9.7e0 SMART
low complexity region 740 750 N/A INTRINSIC
low complexity region 882 892 N/A INTRINSIC
TPR 1055 1088 6.92e1 SMART
low complexity region 1327 1349 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1778 1790 N/A INTRINSIC
low complexity region 1791 1803 N/A INTRINSIC
low complexity region 1810 1831 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Pfam:MEF2_binding 2123 2157 5.7e-26 PFAM
low complexity region 2165 2183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217810
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcineurin plays an important role in the T-cell receptor-mediated signal transduction pathway. The protein encoded by this gene binds specifically to the activated form of calcineurin and inhibits calcineurin-mediated signal transduction. The encoded protein is found in the nucleus and contains a leucine zipper domain as well as several PEST motifs, sequences which confer targeted degradation to those proteins which contain them. Alternative splicing results in multiple transcript variants encoding two different isoforms. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous null mutants exhibit embryonic lethality during organogenesis. Mice producing a truncated protein exhibit elevated levels of serum IgG1, IgG2b and IgE, produce more IgG1 in response to T-cell dependent antigen, and have enhanced expression of cytokines in response to anti-CD3 stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,131,868 M1015L probably benign Het
Aftph T C 11: 20,727,100 S170G probably damaging Het
Aox4 C T 1: 58,231,483 P274S possibly damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
Aspm T A 1: 139,478,676 L1767* probably null Het
Baz2b T A 2: 59,901,491 K2068* probably null Het
Bcl9 A T 3: 97,209,902 V492D probably damaging Het
Bicc1 G T 10: 70,940,522 H782Q probably benign Het
Ccng1 A G 11: 40,752,188 V144A possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ddx1 G T 12: 13,220,435 C668* probably null Het
Dhx58 G A 11: 100,696,976 S585L probably benign Het
Dnttip2 A T 3: 122,275,941 K268N probably damaging Het
Ecd C T 14: 20,324,368 probably null Het
Entpd1 A G 19: 40,725,029 probably null Het
Erlin2 T C 8: 27,033,407 V224A probably damaging Het
Exoc3l4 A G 12: 111,427,990 S515G probably benign Het
Fcho1 T C 8: 71,717,185 D98G possibly damaging Het
Fhod1 T A 8: 105,330,513 D943V probably damaging Het
Gm10322 A T 10: 59,616,268 E69V possibly damaging Het
Gm14295 T A 2: 176,807,417 L19* probably null Het
Gm7347 T A 5: 26,057,374 R50* probably null Het
Hesx1 T C 14: 27,000,774 C19R probably benign Het
Hgh1 T A 15: 76,369,552 F199L probably benign Het
Irak2 T C 6: 113,672,844 F147L probably damaging Het
Kif22 G A 7: 127,033,377 R254C possibly damaging Het
Klhl9 A T 4: 88,721,385 S206R probably damaging Het
Maip1 T C 1: 57,411,851 probably null Het
Mcm9 T A 10: 53,538,060 E308V possibly damaging Het
Mfsd13b A T 7: 120,998,978 N369I possibly damaging Het
Mga T A 2: 119,903,344 H224Q probably damaging Het
Mtss1 A T 15: 58,971,019 W115R probably damaging Het
Myo3b T C 2: 70,258,030 V851A probably benign Het
Nectin2 A T 7: 19,738,124 D113E probably damaging Het
Notch2 G A 3: 98,100,374 C480Y probably damaging Het
Olfr711 G A 7: 106,971,664 R227C probably benign Het
Olfr922 T C 9: 38,816,145 I214T possibly damaging Het
Pfdn1 G T 18: 36,404,413 N111K probably damaging Het
Pfkl A T 10: 77,996,408 V283E probably damaging Het
Plbd2 G T 5: 120,491,184 S305* probably null Het
Prom1 T C 5: 44,000,832 probably null Het
Ptbp2 T A 3: 119,752,964 M90L probably benign Het
Rai1 G A 11: 60,185,919 E270K possibly damaging Het
Rbbp6 G A 7: 123,000,702 probably benign Het
Reln T C 5: 21,896,077 M3399V probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sh2d2a A G 3: 87,851,784 D231G probably benign Het
Smn1 T C 13: 100,137,382 probably benign Het
Snrnp200 C T 2: 127,226,370 Q877* probably null Het
Taf2 G T 15: 55,060,045 H279N probably benign Het
Tnfaip3 T C 10: 19,005,284 Y345C probably damaging Het
Vmn2r68 C T 7: 85,233,868 M225I probably benign Het
Vps13a A T 19: 16,744,893 W352R probably damaging Het
Other mutations in Cabin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Cabin1 APN 10 75725586 missense possibly damaging 0.58
IGL01457:Cabin1 APN 10 75742429 missense probably damaging 0.96
IGL02217:Cabin1 APN 10 75700047 missense possibly damaging 0.95
IGL02649:Cabin1 APN 10 75737418 missense probably damaging 1.00
IGL02737:Cabin1 APN 10 75713585 missense probably benign 0.09
IGL02792:Cabin1 APN 10 75746739 missense probably damaging 1.00
IGL03047:Cabin1 APN 10 75700100 splice site probably benign
IGL03106:Cabin1 APN 10 75733628 missense probably benign 0.01
IGL03276:Cabin1 APN 10 75732413 missense probably damaging 1.00
bison UTSW 10 75684323 missense probably damaging 1.00
range UTSW 10 75658647 missense probably damaging 1.00
R0335:Cabin1 UTSW 10 75657049 missense probably damaging 1.00
R0557:Cabin1 UTSW 10 75726917 missense probably damaging 1.00
R0578:Cabin1 UTSW 10 75713610 missense probably damaging 0.96
R0588:Cabin1 UTSW 10 75745337 missense possibly damaging 0.71
R1115:Cabin1 UTSW 10 75717677 missense possibly damaging 0.70
R1120:Cabin1 UTSW 10 75725716 missense probably damaging 1.00
R1439:Cabin1 UTSW 10 75656806 missense probably damaging 1.00
R1471:Cabin1 UTSW 10 75694792 missense probably damaging 1.00
R1794:Cabin1 UTSW 10 75725745 missense possibly damaging 0.52
R1844:Cabin1 UTSW 10 75743350 splice site probably null
R1959:Cabin1 UTSW 10 75735090 missense possibly damaging 0.92
R2008:Cabin1 UTSW 10 75734976 splice site probably null
R2279:Cabin1 UTSW 10 75753461 missense probably benign
R3150:Cabin1 UTSW 10 75656911 missense probably damaging 1.00
R3929:Cabin1 UTSW 10 75751618 critical splice acceptor site probably null
R3945:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R3946:Cabin1 UTSW 10 75745259 missense probably damaging 1.00
R4206:Cabin1 UTSW 10 75754841 missense possibly damaging 0.69
R4812:Cabin1 UTSW 10 75646594 missense possibly damaging 0.93
R4944:Cabin1 UTSW 10 75721363 missense probably damaging 1.00
R4944:Cabin1 UTSW 10 75739421 missense probably damaging 0.99
R5078:Cabin1 UTSW 10 75721478 missense probably damaging 1.00
R5319:Cabin1 UTSW 10 75725715 missense probably damaging 1.00
R5481:Cabin1 UTSW 10 75735066 missense probably benign 0.29
R5504:Cabin1 UTSW 10 75653009 missense probably benign 0.00
R5710:Cabin1 UTSW 10 75647018 missense probably benign 0.00
R5908:Cabin1 UTSW 10 75721532 missense probably damaging 1.00
R5975:Cabin1 UTSW 10 75657839 missense probably damaging 1.00
R5982:Cabin1 UTSW 10 75725560 missense probably benign 0.00
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6038:Cabin1 UTSW 10 75739366 missense probably benign 0.02
R6114:Cabin1 UTSW 10 75747971 missense probably benign 0.00
R6285:Cabin1 UTSW 10 75684323 missense probably damaging 1.00
R6341:Cabin1 UTSW 10 75658739 missense probably damaging 0.98
R6361:Cabin1 UTSW 10 75726865 missense possibly damaging 0.91
R6395:Cabin1 UTSW 10 75746742 missense probably benign 0.10
R6422:Cabin1 UTSW 10 75656792 missense probably damaging 1.00
R6575:Cabin1 UTSW 10 75725701 missense possibly damaging 0.90
R6763:Cabin1 UTSW 10 75746730 missense probably damaging 0.99
R6845:Cabin1 UTSW 10 75721508 missense probably damaging 1.00
R6936:Cabin1 UTSW 10 75715758 splice site probably null
R7050:Cabin1 UTSW 10 75713542 missense probably damaging 1.00
R7055:Cabin1 UTSW 10 75743283 missense probably benign 0.04
R7101:Cabin1 UTSW 10 75751567 missense probably benign
R7138:Cabin1 UTSW 10 75745353 missense probably damaging 0.98
R7173:Cabin1 UTSW 10 75746562 missense probably benign 0.00
R7265:Cabin1 UTSW 10 75721423 missense
R7284:Cabin1 UTSW 10 75694834 missense
R7472:Cabin1 UTSW 10 75658647 missense probably damaging 1.00
R7571:Cabin1 UTSW 10 75646666 missense probably damaging 1.00
R7617:Cabin1 UTSW 10 75732443 missense possibly damaging 0.85
R7739:Cabin1 UTSW 10 75658658 missense probably damaging 1.00
R7997:Cabin1 UTSW 10 75733775 missense probably benign 0.01
R8347:Cabin1 UTSW 10 75742367 missense probably damaging 0.98
R8544:Cabin1 UTSW 10 75750056 missense probably benign 0.17
R8546:Cabin1 UTSW 10 75742267 missense probably damaging 1.00
R8692:Cabin1 UTSW 10 75751576 missense probably benign 0.28
R8839:Cabin1 UTSW 10 75656816 missense probably benign 0.00
R9010:Cabin1 UTSW 10 75735058 nonsense probably null
R9108:Cabin1 UTSW 10 75657139 missense possibly damaging 0.94
R9204:Cabin1 UTSW 10 75694716 missense probably benign 0.01
R9259:Cabin1 UTSW 10 75746742 missense probably benign
R9312:Cabin1 UTSW 10 75725735 missense probably benign 0.07
R9421:Cabin1 UTSW 10 75657824 missense probably damaging 1.00
R9439:Cabin1 UTSW 10 75745235 missense probably damaging 1.00
R9578:Cabin1 UTSW 10 75754351 missense probably damaging 0.99
R9645:Cabin1 UTSW 10 75658709 missense probably benign 0.36
R9649:Cabin1 UTSW 10 75739405 missense probably damaging 0.98
R9711:Cabin1 UTSW 10 75743256 missense probably benign 0.02
Z1177:Cabin1 UTSW 10 75648123 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGTGGGCATCTCTTATTCCAGAG -3'
(R):5'- ACAAATATTTGGCTAGCCCCAC -3'

Sequencing Primer
(F):5'- GCATCTCTTATTCCAGAGGAGCAG -3'
(R):5'- GTCTGTAATCCTAGCACTCAGAGG -3'
Posted On 2016-06-06