Incidental Mutation 'R5082:Taf2'
ID 387214
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene Name TATA-box binding protein associated factor 2
Synonyms CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150
MMRRC Submission 042671-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5082 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 55015131-55072152 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55060045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 279 (H279N)
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041733]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000041733
AA Change: H279N

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: H279N

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226864
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,131,868 M1015L probably benign Het
Aftph T C 11: 20,727,100 S170G probably damaging Het
Aox4 C T 1: 58,231,483 P274S possibly damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
Aspm T A 1: 139,478,676 L1767* probably null Het
Baz2b T A 2: 59,901,491 K2068* probably null Het
Bcl9 A T 3: 97,209,902 V492D probably damaging Het
Bicc1 G T 10: 70,940,522 H782Q probably benign Het
Cabin1 T A 10: 75,738,330 I640F probably damaging Het
Ccng1 A G 11: 40,752,188 V144A possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ddx1 G T 12: 13,220,435 C668* probably null Het
Dhx58 G A 11: 100,696,976 S585L probably benign Het
Dnttip2 A T 3: 122,275,941 K268N probably damaging Het
Ecd C T 14: 20,324,368 probably null Het
Entpd1 A G 19: 40,725,029 probably null Het
Erlin2 T C 8: 27,033,407 V224A probably damaging Het
Exoc3l4 A G 12: 111,427,990 S515G probably benign Het
Fcho1 T C 8: 71,717,185 D98G possibly damaging Het
Fhod1 T A 8: 105,330,513 D943V probably damaging Het
Gm10322 A T 10: 59,616,268 E69V possibly damaging Het
Gm14295 T A 2: 176,807,417 L19* probably null Het
Gm7347 T A 5: 26,057,374 R50* probably null Het
Hesx1 T C 14: 27,000,774 C19R probably benign Het
Hgh1 T A 15: 76,369,552 F199L probably benign Het
Irak2 T C 6: 113,672,844 F147L probably damaging Het
Kif22 G A 7: 127,033,377 R254C possibly damaging Het
Klhl9 A T 4: 88,721,385 S206R probably damaging Het
Maip1 T C 1: 57,411,851 probably null Het
Mcm9 T A 10: 53,538,060 E308V possibly damaging Het
Mfsd13b A T 7: 120,998,978 N369I possibly damaging Het
Mga T A 2: 119,903,344 H224Q probably damaging Het
Mtss1 A T 15: 58,971,019 W115R probably damaging Het
Myo3b T C 2: 70,258,030 V851A probably benign Het
Nectin2 A T 7: 19,738,124 D113E probably damaging Het
Notch2 G A 3: 98,100,374 C480Y probably damaging Het
Olfr711 G A 7: 106,971,664 R227C probably benign Het
Olfr922 T C 9: 38,816,145 I214T possibly damaging Het
Pfdn1 G T 18: 36,404,413 N111K probably damaging Het
Pfkl A T 10: 77,996,408 V283E probably damaging Het
Plbd2 G T 5: 120,491,184 S305* probably null Het
Prom1 T C 5: 44,000,832 probably null Het
Ptbp2 T A 3: 119,752,964 M90L probably benign Het
Rai1 G A 11: 60,185,919 E270K possibly damaging Het
Rbbp6 G A 7: 123,000,702 probably benign Het
Reln T C 5: 21,896,077 M3399V probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sh2d2a A G 3: 87,851,784 D231G probably benign Het
Smn1 T C 13: 100,137,382 probably benign Het
Snrnp200 C T 2: 127,226,370 Q877* probably null Het
Tnfaip3 T C 10: 19,005,284 Y345C probably damaging Het
Vmn2r68 C T 7: 85,233,868 M225I probably benign Het
Vps13a A T 19: 16,744,893 W352R probably damaging Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 55071449 critical splice acceptor site probably null
IGL00475:Taf2 APN 15 55055850 nonsense probably null
IGL00549:Taf2 APN 15 55031115 missense probably benign 0.03
IGL00839:Taf2 APN 15 55045778 nonsense probably null
IGL01089:Taf2 APN 15 55016581 missense probably benign
IGL01305:Taf2 APN 15 55048274 missense probably damaging 0.99
IGL01532:Taf2 APN 15 55049486 missense possibly damaging 0.94
IGL01903:Taf2 APN 15 55060016 missense probably benign 0.03
IGL02324:Taf2 APN 15 55028376 missense probably benign
IGL02328:Taf2 APN 15 55028376 missense probably benign
IGL02405:Taf2 APN 15 55034155 splice site probably benign
IGL02671:Taf2 APN 15 55034176 missense probably benign 0.01
IGL02832:Taf2 APN 15 55016563 missense probably benign 0.01
IGL03105:Taf2 APN 15 55045799 missense probably benign 0.26
IGL03118:Taf2 APN 15 55052163 missense probably damaging 1.00
ANU22:Taf2 UTSW 15 55048274 missense probably damaging 0.99
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0104:Taf2 UTSW 15 55038338 missense probably benign 0.02
R0183:Taf2 UTSW 15 55055790 missense possibly damaging 0.89
R0326:Taf2 UTSW 15 55047460 missense probably damaging 0.97
R0362:Taf2 UTSW 15 55045929 missense probably damaging 1.00
R0423:Taf2 UTSW 15 55064682 missense probably benign 0.02
R0562:Taf2 UTSW 15 55022188 splice site probably benign
R0609:Taf2 UTSW 15 55060050 missense probably damaging 1.00
R0655:Taf2 UTSW 15 55038294 missense probably damaging 1.00
R0689:Taf2 UTSW 15 55063065 missense possibly damaging 0.60
R0743:Taf2 UTSW 15 55016461 small deletion probably benign
R0898:Taf2 UTSW 15 55060084 missense probably damaging 0.97
R0969:Taf2 UTSW 15 55031157 critical splice acceptor site probably null
R0974:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1145:Taf2 UTSW 15 55016461 small deletion probably benign
R1160:Taf2 UTSW 15 55071397 missense probably benign 0.01
R1376:Taf2 UTSW 15 55016461 small deletion probably benign
R1388:Taf2 UTSW 15 55036625 missense probably benign 0.00
R1416:Taf2 UTSW 15 55038410 missense possibly damaging 0.95
R1458:Taf2 UTSW 15 55059915 missense probably damaging 0.99
R1477:Taf2 UTSW 15 55062172 missense possibly damaging 0.87
R1755:Taf2 UTSW 15 55016454 missense probably damaging 1.00
R1766:Taf2 UTSW 15 55071397 missense probably benign 0.01
R2090:Taf2 UTSW 15 55016486 missense probably damaging 0.99
R2228:Taf2 UTSW 15 55064646 missense possibly damaging 0.94
R2519:Taf2 UTSW 15 55052247 missense probably benign 0.03
R4073:Taf2 UTSW 15 55052237 missense probably damaging 1.00
R4470:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4471:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4472:Taf2 UTSW 15 55058880 missense possibly damaging 0.70
R4716:Taf2 UTSW 15 55065968 missense probably benign 0.02
R4937:Taf2 UTSW 15 55027223 nonsense probably null
R5335:Taf2 UTSW 15 55045740 missense probably benign 0.14
R5383:Taf2 UTSW 15 55049419 missense possibly damaging 0.78
R5771:Taf2 UTSW 15 55059939 missense probably benign 0.01
R5862:Taf2 UTSW 15 55048323 missense possibly damaging 0.95
R5873:Taf2 UTSW 15 55038422 missense probably benign 0.00
R5908:Taf2 UTSW 15 55072006 unclassified probably benign
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6033:Taf2 UTSW 15 55058901 missense probably damaging 1.00
R6159:Taf2 UTSW 15 55063044 missense possibly damaging 0.48
R6568:Taf2 UTSW 15 55064630 missense probably damaging 1.00
R7094:Taf2 UTSW 15 55060086 missense probably benign 0.27
R7174:Taf2 UTSW 15 55048739 missense possibly damaging 0.51
R7241:Taf2 UTSW 15 55062141 missense probably benign 0.01
R7561:Taf2 UTSW 15 55055833 missense probably benign 0.16
R7583:Taf2 UTSW 15 55064676 nonsense probably null
R7818:Taf2 UTSW 15 55065930 missense probably benign
R7905:Taf2 UTSW 15 55047432 missense possibly damaging 0.90
R8006:Taf2 UTSW 15 55048701 missense probably damaging 1.00
R8017:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8019:Taf2 UTSW 15 55064617 missense possibly damaging 0.66
R8119:Taf2 UTSW 15 55031130 missense probably benign 0.00
R8127:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8128:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8129:Taf2 UTSW 15 55059988 missense probably damaging 1.00
R8278:Taf2 UTSW 15 55065965 nonsense probably null
R8290:Taf2 UTSW 15 55063020 missense probably damaging 1.00
R8762:Taf2 UTSW 15 55047453 missense probably benign 0.16
R8832:Taf2 UTSW 15 55064605 missense possibly damaging 0.86
R8916:Taf2 UTSW 15 55036535 missense probably benign 0.26
R8937:Taf2 UTSW 15 55047453 missense probably benign 0.16
R9006:Taf2 UTSW 15 55045905 missense possibly damaging 0.94
R9138:Taf2 UTSW 15 55016461 small deletion probably benign
R9240:Taf2 UTSW 15 55063068 missense probably null 1.00
R9257:Taf2 UTSW 15 55066013 missense possibly damaging 0.46
R9485:Taf2 UTSW 15 55048271 missense probably benign 0.05
R9762:Taf2 UTSW 15 55031044 critical splice donor site probably null
R9766:Taf2 UTSW 15 55047485 critical splice acceptor site probably null
R9796:Taf2 UTSW 15 55047436 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCATCCTCTACTTGAAGGGAC -3'
(R):5'- GACACATAAGAGATTATGCTAAGCC -3'

Sequencing Primer
(F):5'- TTGAAGGGACACCAACCTG -3'
(R):5'- TTAATTCTCATTGATGCATAGGAGAG -3'
Posted On 2016-06-06