Incidental Mutation 'R5082:Mtss1'
ID387215
Institutional Source Beutler Lab
Gene Symbol Mtss1
Ensembl Gene ENSMUSG00000022353
Gene Namemetastasis suppressor 1
SynonymsD130001D01Rik, 2310003N14Rik, MIM
MMRRC Submission 042671-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R5082 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location58941234-59082005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58971019 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 115 (W115R)
Ref Sequence ENSEMBL: ENSMUSP00000079239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080371]
Predicted Effect probably damaging
Transcript: ENSMUST00000080371
AA Change: W115R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079239
Gene: ENSMUSG00000022353
AA Change: W115R

DomainStartEndE-ValueType
Pfam:IMD 16 241 2.1e-107 PFAM
low complexity region 257 309 N/A INTRINSIC
low complexity region 443 459 N/A INTRINSIC
low complexity region 612 628 N/A INTRINSIC
WH2 731 748 1.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228365
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit polycystic kidney in 50% of mice by 5 months of age. Mouse embryonic fibroblasts from mice homozygous for a different gene trap allele exhibit altered cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T A 11: 110,131,868 M1015L probably benign Het
Aftph T C 11: 20,727,100 S170G probably damaging Het
Aox4 C T 1: 58,231,483 P274S possibly damaging Het
Ash1l G A 3: 88,966,234 R108Q probably damaging Het
Aspm T A 1: 139,478,676 L1767* probably null Het
Baz2b T A 2: 59,901,491 K2068* probably null Het
Bcl9 A T 3: 97,209,902 V492D probably damaging Het
Bicc1 G T 10: 70,940,522 H782Q probably benign Het
Cabin1 T A 10: 75,738,330 I640F probably damaging Het
Ccng1 A G 11: 40,752,188 V144A possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Ddx1 G T 12: 13,220,435 C668* probably null Het
Dhx58 G A 11: 100,696,976 S585L probably benign Het
Dnttip2 A T 3: 122,275,941 K268N probably damaging Het
Ecd C T 14: 20,324,368 probably null Het
Entpd1 A G 19: 40,725,029 probably null Het
Erlin2 T C 8: 27,033,407 V224A probably damaging Het
Exoc3l4 A G 12: 111,427,990 S515G probably benign Het
Fcho1 T C 8: 71,717,185 D98G possibly damaging Het
Fhod1 T A 8: 105,330,513 D943V probably damaging Het
Gm10322 A T 10: 59,616,268 E69V possibly damaging Het
Gm14295 T A 2: 176,807,417 L19* probably null Het
Gm7347 T A 5: 26,057,374 R50* probably null Het
Hesx1 T C 14: 27,000,774 C19R probably benign Het
Hgh1 T A 15: 76,369,552 F199L probably benign Het
Irak2 T C 6: 113,672,844 F147L probably damaging Het
Kif22 G A 7: 127,033,377 R254C possibly damaging Het
Klhl9 A T 4: 88,721,385 S206R probably damaging Het
Maip1 T C 1: 57,411,851 probably null Het
Mcm9 T A 10: 53,538,060 E308V possibly damaging Het
Mfsd13b A T 7: 120,998,978 N369I possibly damaging Het
Mga T A 2: 119,903,344 H224Q probably damaging Het
Myo3b T C 2: 70,258,030 V851A probably benign Het
Nectin2 A T 7: 19,738,124 D113E probably damaging Het
Notch2 G A 3: 98,100,374 C480Y probably damaging Het
Olfr711 G A 7: 106,971,664 R227C probably benign Het
Olfr922 T C 9: 38,816,145 I214T possibly damaging Het
Pfdn1 G T 18: 36,404,413 N111K probably damaging Het
Pfkl A T 10: 77,996,408 V283E probably damaging Het
Plbd2 G T 5: 120,491,184 S305* probably null Het
Prom1 T C 5: 44,000,832 probably null Het
Ptbp2 T A 3: 119,752,964 M90L probably benign Het
Rai1 G A 11: 60,185,919 E270K possibly damaging Het
Rbbp6 G A 7: 123,000,702 probably benign Het
Reln T C 5: 21,896,077 M3399V probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sh2d2a A G 3: 87,851,784 D231G probably benign Het
Smn1 T C 13: 100,137,382 probably benign Het
Snrnp200 C T 2: 127,226,370 Q877* probably null Het
Taf2 G T 15: 55,060,045 H279N probably benign Het
Tnfaip3 T C 10: 19,005,284 Y345C probably damaging Het
Vmn2r68 C T 7: 85,233,868 M225I probably benign Het
Vps13a A T 19: 16,744,893 W352R probably damaging Het
Other mutations in Mtss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Mtss1 APN 15 58951468 critical splice donor site probably null
IGL00693:Mtss1 APN 15 58944124 missense probably damaging 1.00
IGL00817:Mtss1 APN 15 58943632 unclassified probably null
IGL00923:Mtss1 APN 15 58943499 missense possibly damaging 0.80
IGL01704:Mtss1 APN 15 59055083 missense possibly damaging 0.91
IGL02257:Mtss1 APN 15 58956545 missense probably damaging 1.00
IGL02632:Mtss1 APN 15 58944015 missense probably damaging 0.99
IGL02829:Mtss1 APN 15 59058428 splice site probably benign
IGL02838:Mtss1 APN 15 59081515 missense probably benign 0.06
IGL02968:Mtss1 APN 15 58956515 missense possibly damaging 0.77
IGL03012:Mtss1 APN 15 59058400 missense probably damaging 0.97
IGL03022:Mtss1 APN 15 58953590 missense probably damaging 1.00
R0193:Mtss1 UTSW 15 58944017 missense probably damaging 0.99
R0498:Mtss1 UTSW 15 58945437 missense probably damaging 1.00
R0510:Mtss1 UTSW 15 58956538 missense probably benign 0.07
R0655:Mtss1 UTSW 15 59081502 missense probably damaging 0.99
R1183:Mtss1 UTSW 15 58971048 missense probably damaging 0.97
R1428:Mtss1 UTSW 15 58947390 missense probably benign 0.04
R1503:Mtss1 UTSW 15 58951672 missense probably damaging 1.00
R1597:Mtss1 UTSW 15 58943711 missense probably damaging 1.00
R1795:Mtss1 UTSW 15 59058400 missense possibly damaging 0.92
R3689:Mtss1 UTSW 15 58953536 missense probably damaging 1.00
R4724:Mtss1 UTSW 15 59081518 missense probably damaging 0.98
R4811:Mtss1 UTSW 15 58944073 missense probably damaging 1.00
R4968:Mtss1 UTSW 15 58943918 missense probably damaging 1.00
R5783:Mtss1 UTSW 15 58943524 missense probably benign 0.05
R6253:Mtss1 UTSW 15 58943719 missense probably benign 0.02
R6767:Mtss1 UTSW 15 58953581 missense probably benign 0.00
R6890:Mtss1 UTSW 15 58951659 missense probably damaging 1.00
R7001:Mtss1 UTSW 15 58948334 intron probably benign
R7502:Mtss1 UTSW 15 58948361 missense probably damaging 0.96
R7722:Mtss1 UTSW 15 59055086 missense probably damaging 1.00
R7867:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7888:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
R7950:Mtss1 UTSW 15 58971009 missense possibly damaging 0.82
R7971:Mtss1 UTSW 15 58972524 missense probably damaging 1.00
Z1177:Mtss1 UTSW 15 58945420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCGCTGAAGTTCTCCAG -3'
(R):5'- GTCTTGACCGCTAAGTGTAAATCC -3'

Sequencing Primer
(F):5'- TTCTCCAGGAACGTGGCTC -3'
(R):5'- CCGCTAAGTGTAAATCCTTTGGGAC -3'
Posted On2016-06-06