Incidental Mutation 'R5083:Slc44a5'
ID387237
Institutional Source Beutler Lab
Gene Symbol Slc44a5
Ensembl Gene ENSMUSG00000028360
Gene Namesolute carrier family 44, member 5
SynonymsLOC242259
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location153973436-154271722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154247787 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 269 (I269L)
Ref Sequence ENSEMBL: ENSMUSP00000087394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089948]
Predicted Effect probably benign
Transcript: ENSMUST00000089948
AA Change: I269L

PolyPhen 2 Score 0.314 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087394
Gene: ENSMUSG00000028360
AA Change: I269L

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
transmembrane domain 263 285 N/A INTRINSIC
Pfam:Choline_transpo 323 683 6.3e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200319
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Slc44a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Slc44a5 APN 3 154262939 missense probably damaging 1.00
IGL02187:Slc44a5 APN 3 154262917 missense probably benign 0.00
IGL02219:Slc44a5 APN 3 154239159 missense possibly damaging 0.76
IGL02220:Slc44a5 APN 3 154250971 missense possibly damaging 0.94
IGL02314:Slc44a5 APN 3 154256519 missense probably damaging 1.00
IGL02471:Slc44a5 APN 3 154256576 missense probably damaging 1.00
IGL02869:Slc44a5 APN 3 154251014 missense probably damaging 0.97
IGL03117:Slc44a5 APN 3 154251077 missense probably benign 0.15
IGL03144:Slc44a5 APN 3 154243540 missense possibly damaging 0.78
PIT4486001:Slc44a5 UTSW 3 154259022 missense possibly damaging 0.50
R0026:Slc44a5 UTSW 3 154240270 splice site probably benign
R0190:Slc44a5 UTSW 3 154239118 missense probably null 0.00
R0306:Slc44a5 UTSW 3 154270001 missense probably damaging 1.00
R0591:Slc44a5 UTSW 3 154234145 splice site probably benign
R0744:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0833:Slc44a5 UTSW 3 154265474 missense probably damaging 1.00
R0919:Slc44a5 UTSW 3 154243586 missense probably damaging 1.00
R1170:Slc44a5 UTSW 3 154257720 intron probably null
R1370:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R1613:Slc44a5 UTSW 3 154257714 intron probably null
R1713:Slc44a5 UTSW 3 154239106 missense probably damaging 0.97
R1999:Slc44a5 UTSW 3 154258493 missense possibly damaging 0.61
R2143:Slc44a5 UTSW 3 154258449 missense probably benign 0.01
R2293:Slc44a5 UTSW 3 154240297 missense probably benign 0.01
R2367:Slc44a5 UTSW 3 154247809 missense possibly damaging 0.94
R3842:Slc44a5 UTSW 3 154261394 splice site probably benign
R3953:Slc44a5 UTSW 3 154171572 missense probably benign 0.03
R4163:Slc44a5 UTSW 3 154261373 missense possibly damaging 0.94
R4509:Slc44a5 UTSW 3 154234073 missense probably damaging 1.00
R4657:Slc44a5 UTSW 3 154256584 missense possibly damaging 0.81
R4936:Slc44a5 UTSW 3 154253716 missense probably damaging 1.00
R4937:Slc44a5 UTSW 3 154243615 critical splice donor site probably null
R5257:Slc44a5 UTSW 3 154243123 missense probably damaging 1.00
R5580:Slc44a5 UTSW 3 154261285 missense probably benign 0.03
R5586:Slc44a5 UTSW 3 154270165 utr 3 prime probably benign
R5856:Slc44a5 UTSW 3 154258392 missense possibly damaging 0.78
R5894:Slc44a5 UTSW 3 154256573 missense probably damaging 1.00
R6228:Slc44a5 UTSW 3 154239163 missense probably benign 0.00
R6248:Slc44a5 UTSW 3 154264041 missense possibly damaging 0.93
R6413:Slc44a5 UTSW 3 154257750 missense probably benign 0.21
R6454:Slc44a5 UTSW 3 154243159 missense probably benign 0.26
R6594:Slc44a5 UTSW 3 154259023 missense possibly damaging 0.85
R6761:Slc44a5 UTSW 3 154240077 intron probably null
R6931:Slc44a5 UTSW 3 154258506 missense probably benign 0.03
R7027:Slc44a5 UTSW 3 154253719 missense probably benign 0.00
R7566:Slc44a5 UTSW 3 154269989 missense probably damaging 1.00
R7688:Slc44a5 UTSW 3 153973800 critical splice donor site probably null
R8011:Slc44a5 UTSW 3 154247810 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGAGCCGTATTTGTACAGACAG -3'
(R):5'- TTCCTGTAAGACCTGAGTCCAAAG -3'

Sequencing Primer
(F):5'- GGAATGTTCTAGAGTGATTTCCAAC -3'
(R):5'- CTGCTAAGGAAAGGAGGAGCTTTTTC -3'
Posted On2016-06-06