Mutagenetix > Incidental Mutations

Incidental Mutation 'R5083:Dtx2'

387244

Institutional Source

Beutler Lab

Gene Symbol

Dtx2

Ensembl Gene

ENSMUSG00000004947

Gene Name

deltex 2, E3 ubiquitin ligase

Synonyms

MMRRC Submission

042672-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

135994800-136032872 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136012190 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 150 (Y150H)

Ref Sequence

ENSEMBL: ENSMUSP00000142472 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005072] [ENSMUST00000111142] [ENSMUST00000111144] [ENSMUST00000111145] [ENSMUST00000125827] [ENSMUST00000130345] [ENSMUST00000199239]

Predicted Effect

probably damaging
Transcript: ENSMUST00000005072
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005072
Gene: ENSMUSG00000004947
AA Change: Y150H

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	408	468	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111142
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106772
Gene: ENSMUSG00000004947
AA Change: Y150H

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	409	469	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111144
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106774
Gene: ENSMUSG00000004947
AA Change: Y150H

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	363	423	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111145
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106775
Gene: ENSMUSG00000004947
AA Change: Y150H

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC
RING	363	423	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000125827
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000115122
Gene: ENSMUSG00000004947
AA Change: Y150H

Domain	Start	End	E-Value	Type
WWE	17	105	2.02e-31	SMART
WWE	107	182	6.98e-26	SMART
low complexity region	281	318	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000130345

Predicted Effect

probably damaging
Transcript: ENSMUST00000199239
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142472
Gene: ENSMUSG00000004947
AA Change: Y150H

Domain	Start	End	E-Value	Type
WWE	17	105	8.4e-34	SMART
WWE	107	151	3.9e-4	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal with no detectable abnormalities in T or B cell development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	C	T	17: 48,166,390	V120M	possibly damaging	Het
Abca6	T	C	11: 110,218,967	D646G	probably damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Arid1b	A	G	17: 5,314,018	T554A	possibly damaging	Het
Atp2a3	G	T	11: 72,982,826	V824L	probably null	Het
Bet1	T	C	6: 4,077,895	I115V	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cfap65	A	G	1: 74,906,441	S1373P	probably damaging	Het
Chd9	T	C	8: 90,984,374	L353P	probably damaging	Het
Chil3	C	A	3: 106,164,089		probably null	Het
Comp	C	T	8: 70,381,300	T655M	probably damaging	Het
Dctd	T	C	8: 48,111,716	Y18H	probably damaging	Het
Ddx39b	G	A	17: 35,253,029	G348D	possibly damaging	Het
Dhx36	A	T	3: 62,471,999	S889R	probably benign	Het
Epx	A	G	11: 87,872,680	F238S	probably damaging	Het
Ergic2	T	C	6: 148,196,014	T154A	probably benign	Het
Esco1	A	G	18: 10,594,734	I184T	probably benign	Het
Esf1	G	T	2: 140,157,071	A495E	possibly damaging	Het
Esf1	T	C	2: 140,158,579	Y429C	possibly damaging	Het
Fcho1	C	A	8: 71,717,176	R101L	probably benign	Het
Foxn4	T	A	5: 114,256,927	D313V	probably damaging	Het
Gm11568	T	C	11: 99,857,972	M1T	probably null	Het
Gm14409	A	G	2: 177,265,571	F45L	probably damaging	Het
Gphn	T	A	12: 78,623,289		probably null	Het
Grid2	C	T	6: 64,320,152	Q500*	probably null	Het
Igsf10	A	G	3: 59,326,273	S1680P	probably damaging	Het
Ints12	T	C	3: 133,100,777	M155T	possibly damaging	Het
Invs	A	T	4: 48,396,307	M327L	possibly damaging	Het
Kdm3a	T	C	6: 71,621,362	E180G	probably damaging	Het
Mgat3	G	A	15: 80,211,298	V109M	possibly damaging	Het
Mrgprb3	A	G	7: 48,643,014	V263A	probably benign	Het
Mroh7	A	T	4: 106,690,318	V1109D	probably benign	Het
Myo15b	A	T	11: 115,866,656	T1111S	probably benign	Het
Myo19	G	T	11: 84,903,211	A654S	possibly damaging	Het
Mypn	A	T	10: 63,118,528	V1224D	probably damaging	Het
Nalcn	A	G	14: 123,323,294		probably null	Het
Olfr250	G	A	9: 38,368,062	C172Y	possibly damaging	Het
Olfr437	G	T	6: 43,167,339	A94S	probably benign	Het
Olfr676	A	T	7: 105,035,411	Y71F	probably damaging	Het
Pdcd2	A	G	17: 15,522,822	I247T	possibly damaging	Het
Pik3c2a	A	T	7: 116,342,401	N1571K	probably damaging	Het
Plagl2	T	C	2: 153,236,044	T6A	probably benign	Het
Ros1	T	A	10: 52,163,941	Y318F	possibly damaging	Het
Sdccag8	C	A	1: 176,824,892	H70N	probably damaging	Het
Skint1	A	G	4: 112,029,433	R359G	probably benign	Het
Slc44a5	A	T	3: 154,247,787	I269L	probably benign	Het
Slfn10-ps	T	A	11: 83,030,515		noncoding transcript	Het
Suclg1	C	A	6: 73,263,980	T164K	probably benign	Het
Tgds	C	A	14: 118,116,079		probably null	Het
Ttn	T	C	2: 76,813,533	D13117G	probably damaging	Het
Ttn	T	C	2: 76,870,737		probably benign	Het
Vmn2r28	A	T	7: 5,480,672	I843N	possibly damaging	Het
Vmn2r52	A	T	7: 10,159,465	Y582*	probably null	Het
Vps33b	G	T	7: 80,274,641	K65N	probably damaging	Het

Other mutations in Dtx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01077:Dtx2	APN	5	136029203	missense	possibly damaging	0.95
IGL01536:Dtx2	APN	5	136010086	utr 5 prime	probably benign
IGL01584:Dtx2	APN	5	136026566	missense	possibly damaging	0.49
IGL01782:Dtx2	APN	5	136010127	nonsense	probably null
IGL03091:Dtx2	APN	5	136012374	missense	probably damaging	1.00
R0499:Dtx2	UTSW	5	136029103	missense	probably damaging	1.00
R0580:Dtx2	UTSW	5	136032326	missense	probably damaging	1.00
R1988:Dtx2	UTSW	5	136032293	nonsense	probably null
R2062:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2063:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2064:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2065:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2068:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2108:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2110:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2111:Dtx2	UTSW	5	136030577	missense	probably damaging	1.00
R2130:Dtx2	UTSW	5	136012040	missense	probably damaging	0.96
R2146:Dtx2	UTSW	5	136030610	missense	probably benign	0.21
R3108:Dtx2	UTSW	5	136021816	missense	probably benign	0.01
R3421:Dtx2	UTSW	5	136012478	missense	probably damaging	1.00
R4467:Dtx2	UTSW	5	136012076	missense	probably damaging	1.00
R4741:Dtx2	UTSW	5	136026517	missense	probably benign	0.00
R5318:Dtx2	UTSW	5	136012100	missense	possibly damaging	0.92
R5705:Dtx2	UTSW	5	136010295	missense	probably damaging	1.00
R5964:Dtx2	UTSW	5	136023699	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTAAAGTGTTAGCGTGTGGAAC -3'
(R):5'- CTACCATGGAGGCACTGTTG -3'

Sequencing Primer
(F):5'- AACAGCAGGAGGGTTCTCATTTATG -3'
(R):5'- CTGTTGGCAAAAGCAGATAAGTCCC -3'

Posted On

2016-06-06