Incidental Mutation 'R5083:Dtx2'
List |< first << previous [record 15 of 55] next >> last >|
ID387244
Institutional Source Beutler Lab
Gene Symbol Dtx2
Ensembl Gene ENSMUSG00000004947
Gene Namedeltex 2, E3 ubiquitin ligase
Synonyms
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135994800-136032872 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136012190 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 150 (Y150H)
Ref Sequence ENSEMBL: ENSMUSP00000142472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005072] [ENSMUST00000111142] [ENSMUST00000111144] [ENSMUST00000111145] [ENSMUST00000125827] [ENSMUST00000130345] [ENSMUST00000199239]
Predicted Effect probably damaging
Transcript: ENSMUST00000005072
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005072
Gene: ENSMUSG00000004947
AA Change: Y150H

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 408 468 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111142
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106772
Gene: ENSMUSG00000004947
AA Change: Y150H

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 409 469 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111144
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106774
Gene: ENSMUSG00000004947
AA Change: Y150H

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111145
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106775
Gene: ENSMUSG00000004947
AA Change: Y150H

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
RING 363 423 2.49e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125827
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115122
Gene: ENSMUSG00000004947
AA Change: Y150H

DomainStartEndE-ValueType
WWE 17 105 2.02e-31 SMART
WWE 107 182 6.98e-26 SMART
low complexity region 281 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130345
Predicted Effect probably damaging
Transcript: ENSMUST00000199239
AA Change: Y150H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142472
Gene: ENSMUSG00000004947
AA Change: Y150H

DomainStartEndE-ValueType
WWE 17 105 8.4e-34 SMART
WWE 107 151 3.9e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX2 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal with no detectable abnormalities in T or B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Dtx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01077:Dtx2 APN 5 136029203 missense possibly damaging 0.95
IGL01536:Dtx2 APN 5 136010086 utr 5 prime probably benign
IGL01584:Dtx2 APN 5 136026566 missense possibly damaging 0.49
IGL01782:Dtx2 APN 5 136010127 nonsense probably null
IGL03091:Dtx2 APN 5 136012374 missense probably damaging 1.00
R0499:Dtx2 UTSW 5 136029103 missense probably damaging 1.00
R0580:Dtx2 UTSW 5 136032326 missense probably damaging 1.00
R1988:Dtx2 UTSW 5 136032293 nonsense probably null
R2062:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2063:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2064:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2065:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2068:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2108:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2110:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2111:Dtx2 UTSW 5 136030577 missense probably damaging 1.00
R2130:Dtx2 UTSW 5 136012040 missense probably damaging 0.96
R2146:Dtx2 UTSW 5 136030610 missense probably benign 0.21
R3108:Dtx2 UTSW 5 136021816 missense probably benign 0.01
R3421:Dtx2 UTSW 5 136012478 missense probably damaging 1.00
R4467:Dtx2 UTSW 5 136012076 missense probably damaging 1.00
R4741:Dtx2 UTSW 5 136026517 missense probably benign 0.00
R5318:Dtx2 UTSW 5 136012100 missense possibly damaging 0.92
R5705:Dtx2 UTSW 5 136010295 missense probably damaging 1.00
R5964:Dtx2 UTSW 5 136023699 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTAAAGTGTTAGCGTGTGGAAC -3'
(R):5'- CTACCATGGAGGCACTGTTG -3'

Sequencing Primer
(F):5'- AACAGCAGGAGGGTTCTCATTTATG -3'
(R):5'- CTGTTGGCAAAAGCAGATAAGTCCC -3'
Posted On2016-06-06