Incidental Mutation 'R5083:Grid2'
ID 387248
Institutional Source Beutler Lab
Gene Symbol Grid2
Ensembl Gene ENSMUSG00000071424
Gene Name glutamate receptor, ionotropic, delta 2
Synonyms tpr, B230104L07Rik, GluRdelta2
MMRRC Submission 042672-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5083 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 63232860-64681307 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 64297136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 500 (Q500*)
Ref Sequence ENSEMBL: ENSMUSP00000093536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095852]
AlphaFold Q61625
Predicted Effect probably null
Transcript: ENSMUST00000095852
AA Change: Q500*
SMART Domains Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: Q500*

DomainStartEndE-ValueType
Pfam:ANF_receptor 39 404 4.1e-41 PFAM
PBPe 442 807 5.98e-108 SMART
Lig_chan-Glu_bd 452 514 3.76e-24 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 945 956 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,473,558 (GRCm39) V120M possibly damaging Het
Abca6 T C 11: 110,109,793 (GRCm39) D646G probably damaging Het
Agbl5 G A 5: 31,060,403 (GRCm39) R141Q probably damaging Het
Arid1b A G 17: 5,364,293 (GRCm39) T554A possibly damaging Het
Atp2a3 G T 11: 72,873,652 (GRCm39) V824L probably null Het
Bet1 T C 6: 4,077,895 (GRCm39) I115V possibly damaging Het
Cdc23 C A 18: 34,784,742 (GRCm39) V7L unknown Het
Cfap65 A G 1: 74,945,600 (GRCm39) S1373P probably damaging Het
Chd9 T C 8: 91,711,002 (GRCm39) L353P probably damaging Het
Chil3 C A 3: 106,071,405 (GRCm39) probably null Het
Comp C T 8: 70,833,950 (GRCm39) T655M probably damaging Het
Dctd T C 8: 48,564,751 (GRCm39) Y18H probably damaging Het
Ddx39b G A 17: 35,472,005 (GRCm39) G348D possibly damaging Het
Dhx36 A T 3: 62,379,420 (GRCm39) S889R probably benign Het
Dtx2 T C 5: 136,041,044 (GRCm39) Y150H probably damaging Het
Epx A G 11: 87,763,506 (GRCm39) F238S probably damaging Het
Ergic2 T C 6: 148,097,512 (GRCm39) T154A probably benign Het
Esco1 A G 18: 10,594,734 (GRCm39) I184T probably benign Het
Esf1 G T 2: 139,998,991 (GRCm39) A495E possibly damaging Het
Esf1 T C 2: 140,000,499 (GRCm39) Y429C possibly damaging Het
Fcho1 C A 8: 72,169,820 (GRCm39) R101L probably benign Het
Foxn4 T A 5: 114,394,988 (GRCm39) D313V probably damaging Het
Gm11568 T C 11: 99,748,798 (GRCm39) M1T probably null Het
Gphn T A 12: 78,670,063 (GRCm39) probably null Het
Igsf10 A G 3: 59,233,694 (GRCm39) S1680P probably damaging Het
Ints12 T C 3: 132,806,538 (GRCm39) M155T possibly damaging Het
Invs A T 4: 48,396,307 (GRCm39) M327L possibly damaging Het
Kdm3a T C 6: 71,598,346 (GRCm39) E180G probably damaging Het
Mgat3 G A 15: 80,095,499 (GRCm39) V109M possibly damaging Het
Mrgprb3 A G 7: 48,292,762 (GRCm39) V263A probably benign Het
Mroh7 A T 4: 106,547,515 (GRCm39) V1109D probably benign Het
Myo15b A T 11: 115,757,482 (GRCm39) T1111S probably benign Het
Myo19 G T 11: 84,794,037 (GRCm39) A654S possibly damaging Het
Mypn A T 10: 62,954,307 (GRCm39) V1224D probably damaging Het
Nalcn A G 14: 123,560,706 (GRCm39) probably null Het
Or2a52 G T 6: 43,144,273 (GRCm39) A94S probably benign Het
Or52e7 A T 7: 104,684,618 (GRCm39) Y71F probably damaging Het
Or8c10 G A 9: 38,279,358 (GRCm39) C172Y possibly damaging Het
Pdcd2 A G 17: 15,743,084 (GRCm39) I247T possibly damaging Het
Pik3c2a A T 7: 115,941,636 (GRCm39) N1571K probably damaging Het
Plagl2 T C 2: 153,077,964 (GRCm39) T6A probably benign Het
Ros1 T A 10: 52,040,037 (GRCm39) Y318F possibly damaging Het
Sdccag8 C A 1: 176,652,458 (GRCm39) H70N probably damaging Het
Skint1 A G 4: 111,886,630 (GRCm39) R359G probably benign Het
Slc44a5 A T 3: 153,953,424 (GRCm39) I269L probably benign Het
Slfn10-ps T A 11: 82,921,341 (GRCm39) noncoding transcript Het
Suclg1 C A 6: 73,240,963 (GRCm39) T164K probably benign Het
Tgds C A 14: 118,353,491 (GRCm39) probably null Het
Ttn T C 2: 76,643,877 (GRCm39) D13117G probably damaging Het
Ttn T C 2: 76,701,081 (GRCm39) probably benign Het
Vmn2r28 A T 7: 5,483,671 (GRCm39) I843N possibly damaging Het
Vmn2r52 A T 7: 9,893,392 (GRCm39) Y582* probably null Het
Vps33b G T 7: 79,924,389 (GRCm39) K65N probably damaging Het
Zfp1010 A G 2: 176,957,364 (GRCm39) F45L probably damaging Het
Other mutations in Grid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Grid2 APN 6 64,322,573 (GRCm39) missense probably damaging 1.00
IGL00596:Grid2 APN 6 64,510,688 (GRCm39) missense possibly damaging 0.93
IGL01686:Grid2 APN 6 64,297,180 (GRCm39) missense probably benign 0.00
IGL01712:Grid2 APN 6 64,642,899 (GRCm39) missense possibly damaging 0.73
IGL02064:Grid2 APN 6 64,040,919 (GRCm39) missense probably benign 0.29
IGL02216:Grid2 APN 6 64,322,650 (GRCm39) missense probably damaging 0.96
IGL02563:Grid2 APN 6 64,322,857 (GRCm39) missense possibly damaging 0.94
IGL02685:Grid2 APN 6 64,322,800 (GRCm39) missense possibly damaging 0.50
IGL03129:Grid2 APN 6 64,040,888 (GRCm39) missense probably damaging 0.98
IGL03324:Grid2 APN 6 64,406,806 (GRCm39) missense possibly damaging 0.88
IGL03395:Grid2 APN 6 63,886,053 (GRCm39) missense possibly damaging 0.94
crawler UTSW 6 64,406,678 (GRCm39) nonsense probably null
swagger UTSW 6 64,372,263 (GRCm39) synonymous probably benign
R0133:Grid2 UTSW 6 64,297,116 (GRCm39) missense probably damaging 1.00
R0147:Grid2 UTSW 6 64,510,571 (GRCm39) missense probably benign
R0193:Grid2 UTSW 6 64,040,937 (GRCm39) missense possibly damaging 0.64
R0370:Grid2 UTSW 6 64,322,718 (GRCm39) missense possibly damaging 0.75
R0399:Grid2 UTSW 6 64,643,036 (GRCm39) missense probably benign 0.33
R0600:Grid2 UTSW 6 63,480,419 (GRCm39) missense probably benign 0.38
R0717:Grid2 UTSW 6 64,643,259 (GRCm39) missense possibly damaging 0.96
R1524:Grid2 UTSW 6 64,406,738 (GRCm39) missense possibly damaging 0.92
R1555:Grid2 UTSW 6 64,406,668 (GRCm39) missense possibly damaging 0.87
R1572:Grid2 UTSW 6 64,406,678 (GRCm39) nonsense probably null
R1762:Grid2 UTSW 6 64,510,638 (GRCm39) missense probably damaging 0.98
R1944:Grid2 UTSW 6 63,886,045 (GRCm39) missense probably damaging 1.00
R1961:Grid2 UTSW 6 63,885,877 (GRCm39) missense probably damaging 1.00
R1969:Grid2 UTSW 6 63,885,902 (GRCm39) nonsense probably null
R2138:Grid2 UTSW 6 64,322,782 (GRCm39) missense probably damaging 0.99
R3500:Grid2 UTSW 6 63,480,383 (GRCm39) missense probably damaging 0.97
R3547:Grid2 UTSW 6 64,297,005 (GRCm39) missense probably damaging 0.97
R3845:Grid2 UTSW 6 64,322,826 (GRCm39) missense possibly damaging 0.62
R4124:Grid2 UTSW 6 63,480,417 (GRCm39) missense probably benign 0.41
R4273:Grid2 UTSW 6 63,886,029 (GRCm39) missense probably damaging 1.00
R4591:Grid2 UTSW 6 64,297,086 (GRCm39) missense probably damaging 1.00
R4701:Grid2 UTSW 6 64,642,899 (GRCm39) missense probably benign 0.27
R4721:Grid2 UTSW 6 64,643,185 (GRCm39) missense probably benign 0.33
R4755:Grid2 UTSW 6 63,885,972 (GRCm39) missense probably benign 0.04
R4869:Grid2 UTSW 6 64,406,724 (GRCm39) missense probably damaging 1.00
R5091:Grid2 UTSW 6 64,053,862 (GRCm39) missense probably benign 0.07
R5117:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R5128:Grid2 UTSW 6 64,642,982 (GRCm39) missense probably benign 0.01
R5386:Grid2 UTSW 6 63,908,089 (GRCm39) missense probably damaging 0.99
R5404:Grid2 UTSW 6 63,907,894 (GRCm39) missense probably damaging 0.99
R5534:Grid2 UTSW 6 63,480,345 (GRCm39) missense probably benign
R5626:Grid2 UTSW 6 64,053,929 (GRCm39) critical splice donor site probably null
R5699:Grid2 UTSW 6 63,885,975 (GRCm39) missense probably damaging 0.99
R5700:Grid2 UTSW 6 64,071,416 (GRCm39) missense possibly damaging 0.95
R5876:Grid2 UTSW 6 64,640,146 (GRCm39) missense probably damaging 1.00
R6446:Grid2 UTSW 6 64,322,577 (GRCm39) missense probably damaging 1.00
R6694:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6697:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6699:Grid2 UTSW 6 63,908,031 (GRCm39) missense possibly damaging 0.92
R6767:Grid2 UTSW 6 63,907,999 (GRCm39) missense probably benign 0.01
R6895:Grid2 UTSW 6 64,372,283 (GRCm39) missense probably damaging 0.99
R6999:Grid2 UTSW 6 64,053,893 (GRCm39) missense possibly damaging 0.80
R7053:Grid2 UTSW 6 64,677,402 (GRCm39) missense unknown
R7126:Grid2 UTSW 6 64,053,794 (GRCm39) missense probably damaging 0.99
R7432:Grid2 UTSW 6 64,252,854 (GRCm39) missense possibly damaging 0.46
R7553:Grid2 UTSW 6 64,053,925 (GRCm39) missense possibly damaging 0.95
R7619:Grid2 UTSW 6 63,908,085 (GRCm39) missense possibly damaging 0.71
R7997:Grid2 UTSW 6 64,297,120 (GRCm39) missense possibly damaging 0.89
R8112:Grid2 UTSW 6 63,885,891 (GRCm39) missense probably damaging 0.99
R8296:Grid2 UTSW 6 63,233,929 (GRCm39) critical splice donor site probably null
R8320:Grid2 UTSW 6 63,233,917 (GRCm39) missense probably benign 0.15
R8467:Grid2 UTSW 6 64,510,635 (GRCm39) missense probably benign 0.01
R8691:Grid2 UTSW 6 63,480,321 (GRCm39) missense probably damaging 0.97
R8890:Grid2 UTSW 6 63,233,923 (GRCm39) missense probably benign
R8965:Grid2 UTSW 6 64,296,990 (GRCm39) missense probably damaging 1.00
R8968:Grid2 UTSW 6 64,643,139 (GRCm39) missense probably benign 0.14
R9220:Grid2 UTSW 6 63,885,888 (GRCm39) missense probably damaging 1.00
R9371:Grid2 UTSW 6 64,677,506 (GRCm39) missense unknown
R9653:Grid2 UTSW 6 63,907,968 (GRCm39) missense possibly damaging 0.75
Z1176:Grid2 UTSW 6 64,640,212 (GRCm39) missense probably benign 0.03
Z1176:Grid2 UTSW 6 63,885,863 (GRCm39) missense possibly damaging 0.76
Z1177:Grid2 UTSW 6 64,322,841 (GRCm39) missense probably damaging 1.00
Z1177:Grid2 UTSW 6 64,322,840 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGAAATGCTCTGATTTTAGGGAG -3'
(R):5'- ACAGCATTCATTAGTTAGGACTGG -3'

Sequencing Primer
(F):5'- TTAGGGAGCAATGTTTATTGACAC -3'
(R):5'- GGTGAGTCTGTTGGTCTAAATACC -3'
Posted On 2016-06-06