Incidental Mutation 'R5083:Kdm3a'
List |< first << previous [record 30 of 55] next >> last >|
ID387249
Institutional Source Beutler Lab
Gene Symbol Kdm3a
Ensembl Gene ENSMUSG00000053470
Gene Namelysine (K)-specific demethylase 3A
SynonymsC230043E16Rik, Jmjd1a, Tsga, 1700105C21Rik, Jmjd1
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.953) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location71588972-71632990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71621362 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 180 (E180G)
Ref Sequence ENSEMBL: ENSMUSP00000145719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065509] [ENSMUST00000167220] [ENSMUST00000205289] [ENSMUST00000207023]
Predicted Effect probably damaging
Transcript: ENSMUST00000065509
AA Change: E180G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000065716
Gene: ENSMUSG00000053470
AA Change: E180G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167220
AA Change: E180G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128789
Gene: ENSMUSG00000053470
AA Change: E180G

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205289
AA Change: E180G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206704
Predicted Effect probably damaging
Transcript: ENSMUST00000207023
AA Change: E180G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein that contains a jumonji domain and may play a role in hormone-dependent transcriptional activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Male mice homozygous for a hypomorphic allele display infertility, oligoasthenoteratozoospermia, small testis, and impaired spermiogenesis. Mice homozygous for a null allele exhibit abnormal spermatogenesis and obesity associated with hyperlipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Kdm3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Kdm3a APN 6 71600117 missense probably damaging 1.00
IGL02219:Kdm3a APN 6 71600734 missense probably benign 0.01
IGL02423:Kdm3a APN 6 71614003 splice site probably benign
IGL02427:Kdm3a APN 6 71592200 splice site probably benign
IGL02519:Kdm3a APN 6 71611586 missense probably benign 0.04
IGL03143:Kdm3a APN 6 71596861 missense probably damaging 0.98
IGL03279:Kdm3a APN 6 71611675 missense probably benign
R0194:Kdm3a UTSW 6 71624594 missense probably null 0.44
R0408:Kdm3a UTSW 6 71611679 missense probably benign 0.00
R0426:Kdm3a UTSW 6 71600755 missense probably damaging 1.00
R0608:Kdm3a UTSW 6 71620046 missense probably benign 0.01
R1175:Kdm3a UTSW 6 71600027 missense possibly damaging 0.94
R1835:Kdm3a UTSW 6 71613956 missense probably benign 0.14
R3821:Kdm3a UTSW 6 71611677 missense probably benign 0.00
R5536:Kdm3a UTSW 6 71611936 missense probably benign 0.31
R5903:Kdm3a UTSW 6 71632250 start gained probably benign
R5965:Kdm3a UTSW 6 71621380 missense probably benign 0.21
R6236:Kdm3a UTSW 6 71611657 missense probably benign 0.00
R6541:Kdm3a UTSW 6 71594533 missense possibly damaging 0.69
R6666:Kdm3a UTSW 6 71611990 missense probably benign 0.00
R7090:Kdm3a UTSW 6 71595545 missense possibly damaging 0.69
R7112:Kdm3a UTSW 6 71632170 missense probably benign
R7136:Kdm3a UTSW 6 71611780 missense probably benign 0.00
R7163:Kdm3a UTSW 6 71632077 missense probably damaging 1.00
R7608:Kdm3a UTSW 6 71600747 missense probably benign 0.01
R7614:Kdm3a UTSW 6 71591953 missense possibly damaging 0.82
R7683:Kdm3a UTSW 6 71599454 missense probably benign
R7687:Kdm3a UTSW 6 71599492 missense possibly damaging 0.64
R7868:Kdm3a UTSW 6 71595489 missense probably benign 0.31
R7951:Kdm3a UTSW 6 71595489 missense probably benign 0.31
RF053:Kdm3a UTSW 6 71632049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- AGGATCTGTTGGTCACATAGTAC -3'
(R):5'- CAGTTCACTGGAGTTGCAGTAG -3'

Sequencing Primer
(F):5'- TCTGTTGGTCACATAGTACCATATAG -3'
(R):5'- TGCAGTAGTTTGTTAGGTACAGTC -3'
Posted On2016-06-06