Incidental Mutation 'R5083:Suclg1'
ID387250
Institutional Source Beutler Lab
Gene Symbol Suclg1
Ensembl Gene ENSMUSG00000052738
Gene Namesuccinate-CoA ligase, GDP-forming, alpha subunit
SynonymsSucla1, 1500000I01Rik
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location73248382-73276911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73263980 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 164 (T164K)
Ref Sequence ENSEMBL: ENSMUSP00000065113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064740] [ENSMUST00000123159] [ENSMUST00000203632]
Predicted Effect probably benign
Transcript: ENSMUST00000064740
AA Change: T164K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000065113
Gene: ENSMUSG00000052738
AA Change: T164K

DomainStartEndE-ValueType
low complexity region 1 29 N/A INTRINSIC
CoA_binding 51 147 6.28e-35 SMART
Pfam:Succ_CoA_lig 193 336 6.7e-11 PFAM
Pfam:Ligase_CoA 199 324 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173409
Predicted Effect probably benign
Transcript: ENSMUST00000203632
SMART Domains Protein: ENSMUSP00000145246
Gene: ENSMUSG00000052738

DomainStartEndE-ValueType
low complexity region 1 28 N/A INTRINSIC
PDB:1EUD|A 37 67 2e-12 PDB
SCOP:d1euca1 41 68 6e-13 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of the heterodimeric enzyme succinate coenzyme A ligase. This enzyme is targeted to the mitochondria and catalyzes the conversion of succinyl CoA and ADP or GDP to succinate and ATP or GTP. Mutations in this gene are the cause of the metabolic disorder fatal infantile lactic acidosis and mitochondrial DNA depletion. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Suclg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Suclg1 APN 6 73264297 intron probably benign
IGL02657:Suclg1 APN 6 73260521 missense probably damaging 1.00
IGL03250:Suclg1 APN 6 73270992 missense probably benign 0.04
IGL03306:Suclg1 APN 6 73270992 missense probably benign 0.04
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0012:Suclg1 UTSW 6 73270997 missense possibly damaging 0.66
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0038:Suclg1 UTSW 6 73260503 missense probably benign 0.26
R0379:Suclg1 UTSW 6 73256228 missense possibly damaging 0.89
R0969:Suclg1 UTSW 6 73271116 missense probably benign 0.33
R1123:Suclg1 UTSW 6 73256227 missense probably benign 0.02
R2089:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R2091:Suclg1 UTSW 6 73264276 missense probably benign 0.00
R6176:Suclg1 UTSW 6 73275343 missense probably damaging 1.00
R6313:Suclg1 UTSW 6 73256209 missense probably damaging 0.97
R6338:Suclg1 UTSW 6 73264246 missense probably damaging 1.00
R7231:Suclg1 UTSW 6 73263971 missense probably benign 0.00
R7246:Suclg1 UTSW 6 73276713 missense unknown
R7250:Suclg1 UTSW 6 73271091 missense probably benign 0.00
R7524:Suclg1 UTSW 6 73263841 missense probably damaging 0.99
R7829:Suclg1 UTSW 6 73275243 intron probably null
Predicted Primers PCR Primer
(F):5'- TGTTTCAGGCCAAAGAGAAAAC -3'
(R):5'- CGATTTTGCATTCTCCAGGC -3'

Sequencing Primer
(F):5'- TTTCAGGCCAAAGAGAAAACAGGAG -3'
(R):5'- ATTCTAACCCCTAAGTCACATGTG -3'
Posted On2016-06-06