Incidental Mutation 'R5083:Vps33b'
ID387255
Institutional Source Beutler Lab
Gene Symbol Vps33b
Ensembl Gene ENSMUSG00000030534
Gene Namevacuolar protein sorting 33B
Synonyms
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location80269649-80291754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80274641 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 65 (K65N)
Ref Sequence ENSEMBL: ENSMUSP00000138224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032749] [ENSMUST00000135053] [ENSMUST00000150585]
Predicted Effect probably damaging
Transcript: ENSMUST00000032749
AA Change: K65N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534
AA Change: K65N

DomainStartEndE-ValueType
Pfam:Sec1 37 611 2.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128254
Predicted Effect probably benign
Transcript: ENSMUST00000135053
SMART Domains Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
SCOP:d1epua_ 18 59 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145594
Predicted Effect probably damaging
Transcript: ENSMUST00000150585
AA Change: K65N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534
AA Change: K65N

DomainStartEndE-ValueType
Pfam:Sec1 36 140 1.5e-12 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C vacuolar protein sorting proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Mutations in this gene are associated with arthrogryposis-renal dysfunction-cholestasis syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry scaly skin, hair loss, thrombocytosis, abnormal alpha-granule development, extramedullary hematopoiesis, abnormal platelets and megakaryocytes, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Other mutations in Vps33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Vps33b APN 7 80285843 missense probably damaging 1.00
IGL01352:Vps33b APN 7 80285059 splice site probably null
IGL01863:Vps33b APN 7 80274311 critical splice donor site probably null
IGL01918:Vps33b APN 7 80287812 splice site probably null
IGL02152:Vps33b APN 7 80285069 missense probably benign 0.29
IGL02364:Vps33b APN 7 80287839 missense probably damaging 1.00
IGL02383:Vps33b APN 7 80285334 splice site probably null
IGL02669:Vps33b APN 7 80276038 splice site probably benign
IGL03104:Vps33b APN 7 80276083 missense probably damaging 1.00
IGL03333:Vps33b APN 7 80274225 splice site probably benign
PIT4651001:Vps33b UTSW 7 80290007 missense probably damaging 0.99
R0267:Vps33b UTSW 7 80286054 missense possibly damaging 0.87
R0379:Vps33b UTSW 7 80283414 splice site probably null
R0971:Vps33b UTSW 7 80287899 missense possibly damaging 0.75
R1184:Vps33b UTSW 7 80282486 missense probably benign 0.02
R1639:Vps33b UTSW 7 80284353 missense probably damaging 1.00
R1693:Vps33b UTSW 7 80287893 missense probably damaging 1.00
R4502:Vps33b UTSW 7 80287907 missense possibly damaging 0.94
R4609:Vps33b UTSW 7 80291118 missense probably benign 0.00
R4748:Vps33b UTSW 7 80290048 missense probably damaging 1.00
R5304:Vps33b UTSW 7 80274253 missense probably damaging 1.00
R5774:Vps33b UTSW 7 80285340 missense probably benign 0.38
R5991:Vps33b UTSW 7 80283414 splice site probably null
R7085:Vps33b UTSW 7 80276089 missense probably benign 0.12
R7409:Vps33b UTSW 7 80285269 missense probably damaging 0.97
R8025:Vps33b UTSW 7 80290346 splice site probably benign
X0018:Vps33b UTSW 7 80290565 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGACAGTCAGCTCACCTGG -3'
(R):5'- GCATGACACTGTGAGCACTCAG -3'

Sequencing Primer
(F):5'- ACCTGGGCGGGCACATG -3'
(R):5'- CACTGTGAGCACTCAGGGAAC -3'
Posted On2016-06-06