Mutagenetix > Incidental Mutation

Incidental Mutation 'R5083:Pik3c2a'

387257

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2a

Ensembl Gene

ENSMUSG00000030660

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha

Synonyms

PI3KC2

MMRRC Submission

042672-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115936500-116042684 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 115941636 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1571 (N1571K)

Ref Sequence

ENSEMBL: ENSMUSP00000146181 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170430] [ENSMUST00000206219]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000170430
AA Change: N1571K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126092
Gene: ENSMUSG00000030660
AA Change: N1571K

Domain	Start	End	E-Value	Type
low complexity region	28	43	N/A	INTRINSIC
low complexity region	361	372	N/A	INTRINSIC
PI3K_rbd	410	513	3.08e-38	SMART
PI3K_C2	674	783	2.71e-34	SMART
PI3Ka	860	1047	3.62e-85	SMART
PI3Kc	1134	1396	3.1e-125	SMART
PX	1422	1534	5.68e-30	SMART
C2	1573	1677	3.93e-14	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205941

Predicted Effect

probably damaging
Transcript: ENSMUST00000206219
AA Change: N1571K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206248

Predicted Effect

probably benign
Transcript: ENSMUST00000206385

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206492

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206805

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is not sensitive to nanomolar levels of the inhibitor wortmanin. This protein was shown to be able to be activated by insulin and may be involved in integrin-dependent signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele show chronic renal failure and a range of renal lesions that precede immune involvement. Mice heterozygous for a kinase-inactivating allele show defects in platelet formation, platelet membrane morphology and dynamics, and an enrichment of barbell proplatelets. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	C	T	17: 48,473,558 (GRCm39)	V120M	possibly damaging	Het
Abca6	T	C	11: 110,109,793 (GRCm39)	D646G	probably damaging	Het
Agbl5	G	A	5: 31,060,403 (GRCm39)	R141Q	probably damaging	Het
Arid1b	A	G	17: 5,364,293 (GRCm39)	T554A	possibly damaging	Het
Atp2a3	G	T	11: 72,873,652 (GRCm39)	V824L	probably null	Het
Bet1	T	C	6: 4,077,895 (GRCm39)	I115V	possibly damaging	Het
Cdc23	C	A	18: 34,784,742 (GRCm39)	V7L	unknown	Het
Cfap65	A	G	1: 74,945,600 (GRCm39)	S1373P	probably damaging	Het
Chd9	T	C	8: 91,711,002 (GRCm39)	L353P	probably damaging	Het
Chil3	C	A	3: 106,071,405 (GRCm39)		probably null	Het
Comp	C	T	8: 70,833,950 (GRCm39)	T655M	probably damaging	Het
Dctd	T	C	8: 48,564,751 (GRCm39)	Y18H	probably damaging	Het
Ddx39b	G	A	17: 35,472,005 (GRCm39)	G348D	possibly damaging	Het
Dhx36	A	T	3: 62,379,420 (GRCm39)	S889R	probably benign	Het
Dtx2	T	C	5: 136,041,044 (GRCm39)	Y150H	probably damaging	Het
Epx	A	G	11: 87,763,506 (GRCm39)	F238S	probably damaging	Het
Ergic2	T	C	6: 148,097,512 (GRCm39)	T154A	probably benign	Het
Esco1	A	G	18: 10,594,734 (GRCm39)	I184T	probably benign	Het
Esf1	G	T	2: 139,998,991 (GRCm39)	A495E	possibly damaging	Het
Esf1	T	C	2: 140,000,499 (GRCm39)	Y429C	possibly damaging	Het
Fcho1	C	A	8: 72,169,820 (GRCm39)	R101L	probably benign	Het
Foxn4	T	A	5: 114,394,988 (GRCm39)	D313V	probably damaging	Het
Gm11568	T	C	11: 99,748,798 (GRCm39)	M1T	probably null	Het
Gphn	T	A	12: 78,670,063 (GRCm39)		probably null	Het
Grid2	C	T	6: 64,297,136 (GRCm39)	Q500*	probably null	Het
Igsf10	A	G	3: 59,233,694 (GRCm39)	S1680P	probably damaging	Het
Ints12	T	C	3: 132,806,538 (GRCm39)	M155T	possibly damaging	Het
Invs	A	T	4: 48,396,307 (GRCm39)	M327L	possibly damaging	Het
Kdm3a	T	C	6: 71,598,346 (GRCm39)	E180G	probably damaging	Het
Mgat3	G	A	15: 80,095,499 (GRCm39)	V109M	possibly damaging	Het
Mrgprb3	A	G	7: 48,292,762 (GRCm39)	V263A	probably benign	Het
Mroh7	A	T	4: 106,547,515 (GRCm39)	V1109D	probably benign	Het
Myo15b	A	T	11: 115,757,482 (GRCm39)	T1111S	probably benign	Het
Myo19	G	T	11: 84,794,037 (GRCm39)	A654S	possibly damaging	Het
Mypn	A	T	10: 62,954,307 (GRCm39)	V1224D	probably damaging	Het
Nalcn	A	G	14: 123,560,706 (GRCm39)		probably null	Het
Or2a52	G	T	6: 43,144,273 (GRCm39)	A94S	probably benign	Het
Or52e7	A	T	7: 104,684,618 (GRCm39)	Y71F	probably damaging	Het
Or8c10	G	A	9: 38,279,358 (GRCm39)	C172Y	possibly damaging	Het
Pdcd2	A	G	17: 15,743,084 (GRCm39)	I247T	possibly damaging	Het
Plagl2	T	C	2: 153,077,964 (GRCm39)	T6A	probably benign	Het
Ros1	T	A	10: 52,040,037 (GRCm39)	Y318F	possibly damaging	Het
Sdccag8	C	A	1: 176,652,458 (GRCm39)	H70N	probably damaging	Het
Skint1	A	G	4: 111,886,630 (GRCm39)	R359G	probably benign	Het
Slc44a5	A	T	3: 153,953,424 (GRCm39)	I269L	probably benign	Het
Slfn10-ps	T	A	11: 82,921,341 (GRCm39)		noncoding transcript	Het
Suclg1	C	A	6: 73,240,963 (GRCm39)	T164K	probably benign	Het
Tgds	C	A	14: 118,353,491 (GRCm39)		probably null	Het
Ttn	T	C	2: 76,643,877 (GRCm39)	D13117G	probably damaging	Het
Ttn	T	C	2: 76,701,081 (GRCm39)		probably benign	Het
Vmn2r28	A	T	7: 5,483,671 (GRCm39)	I843N	possibly damaging	Het
Vmn2r52	A	T	7: 9,893,392 (GRCm39)	Y582*	probably null	Het
Vps33b	G	T	7: 79,924,389 (GRCm39)	K65N	probably damaging	Het
Zfp1010	A	G	2: 176,957,364 (GRCm39)	F45L	probably damaging	Het

Other mutations in Pik3c2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Pik3c2a	APN	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
IGL00732:Pik3c2a	APN	7	115,963,735 (GRCm39)	missense	possibly damaging	0.82
IGL01303:Pik3c2a	APN	7	115,973,038 (GRCm39)	missense	possibly damaging	0.94
IGL01443:Pik3c2a	APN	7	116,017,429 (GRCm39)	missense	probably benign	0.01
IGL01462:Pik3c2a	APN	7	115,975,485 (GRCm39)	missense	possibly damaging	0.94
IGL01641:Pik3c2a	APN	7	115,950,000 (GRCm39)	intron	probably benign
IGL01695:Pik3c2a	APN	7	116,016,753 (GRCm39)	missense	possibly damaging	0.82
IGL02095:Pik3c2a	APN	7	115,945,423 (GRCm39)	missense	probably damaging	1.00
IGL02137:Pik3c2a	APN	7	115,950,039 (GRCm39)	missense	probably benign	0.00
IGL02160:Pik3c2a	APN	7	115,987,299 (GRCm39)	missense	probably damaging	1.00
IGL02224:Pik3c2a	APN	7	115,962,575 (GRCm39)	splice site	probably benign
IGL02345:Pik3c2a	APN	7	116,005,126 (GRCm39)	missense	probably damaging	1.00
IGL02644:Pik3c2a	APN	7	115,972,049 (GRCm39)	missense	probably benign	0.00
IGL02756:Pik3c2a	APN	7	115,963,748 (GRCm39)	missense	probably benign	0.01
IGL03339:Pik3c2a	APN	7	116,017,256 (GRCm39)	missense	possibly damaging	0.57
IGL03412:Pik3c2a	APN	7	116,017,074 (GRCm39)	missense	probably benign	0.21
R0046:Pik3c2a	UTSW	7	115,953,307 (GRCm39)	missense	probably damaging	1.00
R0387:Pik3c2a	UTSW	7	115,972,979 (GRCm39)	missense	probably damaging	1.00
R0501:Pik3c2a	UTSW	7	115,953,290 (GRCm39)	missense	probably damaging	1.00
R0650:Pik3c2a	UTSW	7	115,945,482 (GRCm39)	splice site	probably benign
R0991:Pik3c2a	UTSW	7	115,961,280 (GRCm39)	critical splice donor site	probably null
R1074:Pik3c2a	UTSW	7	115,950,160 (GRCm39)	nonsense	probably null
R1485:Pik3c2a	UTSW	7	116,016,908 (GRCm39)	missense	possibly damaging	0.50
R1495:Pik3c2a	UTSW	7	115,987,300 (GRCm39)	missense	probably benign	0.01
R1510:Pik3c2a	UTSW	7	115,987,280 (GRCm39)	missense	probably benign	0.00
R1654:Pik3c2a	UTSW	7	115,968,083 (GRCm39)	missense	probably benign	0.02
R1711:Pik3c2a	UTSW	7	116,017,162 (GRCm39)	nonsense	probably null
R1733:Pik3c2a	UTSW	7	116,017,755 (GRCm39)	start codon destroyed	possibly damaging	0.96
R1751:Pik3c2a	UTSW	7	115,945,471 (GRCm39)	missense	probably damaging	0.98
R1812:Pik3c2a	UTSW	7	116,016,899 (GRCm39)	missense	probably damaging	0.98
R1817:Pik3c2a	UTSW	7	115,975,747 (GRCm39)	critical splice donor site	probably null
R1826:Pik3c2a	UTSW	7	115,967,352 (GRCm39)	missense	probably benign
R1875:Pik3c2a	UTSW	7	116,017,206 (GRCm39)	missense	probably benign	0.35
R1995:Pik3c2a	UTSW	7	115,953,241 (GRCm39)	missense	probably damaging	1.00
R2007:Pik3c2a	UTSW	7	115,941,472 (GRCm39)	missense	probably damaging	1.00
R2009:Pik3c2a	UTSW	7	115,963,738 (GRCm39)	missense	probably damaging	1.00
R2013:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2014:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2015:Pik3c2a	UTSW	7	115,950,166 (GRCm39)	critical splice acceptor site	probably null
R2027:Pik3c2a	UTSW	7	115,950,057 (GRCm39)	missense	probably damaging	1.00
R2050:Pik3c2a	UTSW	7	116,016,686 (GRCm39)	critical splice donor site	probably null
R2068:Pik3c2a	UTSW	7	115,972,126 (GRCm39)	nonsense	probably null
R3814:Pik3c2a	UTSW	7	115,947,414 (GRCm39)	missense	probably damaging	1.00
R3848:Pik3c2a	UTSW	7	115,963,785 (GRCm39)	nonsense	probably null
R4386:Pik3c2a	UTSW	7	115,953,334 (GRCm39)	missense	probably damaging	1.00
R4668:Pik3c2a	UTSW	7	115,957,923 (GRCm39)	missense	probably benign	0.16
R4783:Pik3c2a	UTSW	7	116,017,060 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R4860:Pik3c2a	UTSW	7	115,939,391 (GRCm39)	missense	probably damaging	1.00
R5057:Pik3c2a	UTSW	7	115,975,518 (GRCm39)	missense	possibly damaging	0.50
R5080:Pik3c2a	UTSW	7	115,947,509 (GRCm39)	missense	probably damaging	1.00
R5144:Pik3c2a	UTSW	7	115,950,021 (GRCm39)	missense	probably benign	0.01
R5589:Pik3c2a	UTSW	7	116,016,893 (GRCm39)	missense	probably benign	0.02
R5646:Pik3c2a	UTSW	7	116,005,186 (GRCm39)	missense	probably damaging	1.00
R5829:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R5951:Pik3c2a	UTSW	7	115,967,419 (GRCm39)	missense	probably damaging	0.96
R5958:Pik3c2a	UTSW	7	115,961,799 (GRCm39)	missense	probably damaging	1.00
R6356:Pik3c2a	UTSW	7	115,947,440 (GRCm39)	missense	possibly damaging	0.46
R6551:Pik3c2a	UTSW	7	116,016,731 (GRCm39)	missense	probably damaging	0.97
R6641:Pik3c2a	UTSW	7	115,939,460 (GRCm39)	critical splice acceptor site	probably null
R6661:Pik3c2a	UTSW	7	115,967,993 (GRCm39)	missense	possibly damaging	0.77
R6789:Pik3c2a	UTSW	7	115,961,419 (GRCm39)	missense	probably damaging	1.00
R6874:Pik3c2a	UTSW	7	115,993,540 (GRCm39)	missense	probably damaging	1.00
R6985:Pik3c2a	UTSW	7	116,017,223 (GRCm39)	missense	probably damaging	0.98
R7106:Pik3c2a	UTSW	7	116,017,368 (GRCm39)	nonsense	probably null
R7153:Pik3c2a	UTSW	7	115,941,487 (GRCm39)	missense	probably damaging	1.00
R7176:Pik3c2a	UTSW	7	115,987,331 (GRCm39)	missense	possibly damaging	0.47
R7265:Pik3c2a	UTSW	7	115,987,321 (GRCm39)	missense	probably damaging	1.00
R7303:Pik3c2a	UTSW	7	116,005,178 (GRCm39)	missense	probably benign	0.00
R7308:Pik3c2a	UTSW	7	115,973,074 (GRCm39)	missense	probably damaging	1.00
R7375:Pik3c2a	UTSW	7	115,975,621 (GRCm39)	missense	probably damaging	1.00
R7406:Pik3c2a	UTSW	7	115,953,242 (GRCm39)	missense	probably damaging	1.00
R7426:Pik3c2a	UTSW	7	115,972,089 (GRCm39)	missense	probably damaging	1.00
R7528:Pik3c2a	UTSW	7	115,993,474 (GRCm39)	missense	probably damaging	1.00
R7539:Pik3c2a	UTSW	7	115,939,331 (GRCm39)	missense	probably damaging	0.97
R7684:Pik3c2a	UTSW	7	115,987,312 (GRCm39)	nonsense	probably null
R7737:Pik3c2a	UTSW	7	115,955,488 (GRCm39)	missense	probably damaging	0.99
R7739:Pik3c2a	UTSW	7	115,993,529 (GRCm39)	missense	probably benign	0.26
R7852:Pik3c2a	UTSW	7	116,016,693 (GRCm39)	missense	probably benign
R7922:Pik3c2a	UTSW	7	115,990,517 (GRCm39)	missense	probably damaging	1.00
R7956:Pik3c2a	UTSW	7	115,949,350 (GRCm39)	missense	probably benign	0.01
R8005:Pik3c2a	UTSW	7	116,017,271 (GRCm39)	missense	probably damaging	1.00
R8158:Pik3c2a	UTSW	7	115,942,232 (GRCm39)	missense	probably benign	0.00
R8329:Pik3c2a	UTSW	7	116,017,283 (GRCm39)	missense	probably damaging	1.00
R8478:Pik3c2a	UTSW	7	116,017,584 (GRCm39)	missense	probably damaging	0.96
R8736:Pik3c2a	UTSW	7	115,975,464 (GRCm39)	missense	possibly damaging	0.47
R8812:Pik3c2a	UTSW	7	115,951,112 (GRCm39)	missense	probably damaging	1.00
R8922:Pik3c2a	UTSW	7	116,017,659 (GRCm39)	missense	probably damaging	1.00
R8953:Pik3c2a	UTSW	7	115,987,320 (GRCm39)	missense	probably benign	0.19
R9105:Pik3c2a	UTSW	7	115,972,049 (GRCm39)	missense	probably benign	0.00
R9111:Pik3c2a	UTSW	7	115,993,531 (GRCm39)	missense	probably damaging	0.99
R9152:Pik3c2a	UTSW	7	116,017,004 (GRCm39)	missense	probably benign	0.30
R9241:Pik3c2a	UTSW	7	116,017,115 (GRCm39)	missense	probably benign	0.02
R9301:Pik3c2a	UTSW	7	115,945,413 (GRCm39)	missense	probably damaging	1.00
R9325:Pik3c2a	UTSW	7	115,990,558 (GRCm39)	missense	probably damaging	0.99
R9482:Pik3c2a	UTSW	7	115,961,289 (GRCm39)	missense	probably benign	0.04
R9513:Pik3c2a	UTSW	7	115,939,321 (GRCm39)	missense	probably benign	0.06
R9569:Pik3c2a	UTSW	7	115,957,939 (GRCm39)	missense	possibly damaging	0.89
R9758:Pik3c2a	UTSW	7	115,945,427 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCAGGTATGTTTTGACATAGGG -3'
(R):5'- GGCCAGAAATCAGCTCTTCC -3'

Sequencing Primer
(F):5'- ACATAGGGATTTGGGTCAGCC -3'
(R):5'- ATACACATGCCTGCAGAGGTCTG -3'

Posted On

2016-06-06