Incidental Mutation 'R5083:Dctd'
ID387258
Institutional Source Beutler Lab
Gene Symbol Dctd
Ensembl Gene ENSMUSG00000031562
Gene NamedCMP deaminase
Synonyms
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48099092-48153233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48111716 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 18 (Y18H)
Ref Sequence ENSEMBL: ENSMUSP00000134195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033966] [ENSMUST00000170263] [ENSMUST00000174278] [ENSMUST00000174379] [ENSMUST00000174818]
Predicted Effect probably damaging
Transcript: ENSMUST00000033966
AA Change: Y18H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033966
Gene: ENSMUSG00000031562
AA Change: Y18H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098773
Predicted Effect probably damaging
Transcript: ENSMUST00000170263
AA Change: Y18H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126733
Gene: ENSMUSG00000031562
AA Change: Y18H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173991
Predicted Effect probably damaging
Transcript: ENSMUST00000174278
AA Change: Y18H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133445
Gene: ENSMUSG00000031562
AA Change: Y18H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174379
AA Change: Y18H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134195
Gene: ENSMUSG00000031562
AA Change: Y18H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 103 3.5e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174818
AA Change: Y18H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134003
Gene: ENSMUSG00000031562
AA Change: Y18H

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 131 1.5e-27 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the deamination of dCMP to dUMP, the nucleotide substrate for thymidylate synthase. The encoded protein is allosterically activated by dCTP and inhibited by dTTP, and is found as a homohexamer. This protein uses zinc as a cofactor for its activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Dctd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Dctd APN 8 48111662 start gained probably benign
R0194:Dctd UTSW 8 48112078 missense probably benign 0.01
R4871:Dctd UTSW 8 48137414 intron probably benign
R5007:Dctd UTSW 8 48137414 intron probably benign
R5008:Dctd UTSW 8 48137414 intron probably benign
R5009:Dctd UTSW 8 48137414 intron probably benign
R5010:Dctd UTSW 8 48137414 intron probably benign
R5381:Dctd UTSW 8 48137414 intron probably benign
R5382:Dctd UTSW 8 48137414 intron probably benign
R7131:Dctd UTSW 8 48112040 missense probably benign 0.02
X0057:Dctd UTSW 8 48140360 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCTAGGGCTCATGTTTCATG -3'
(R):5'- ATAGCTGGGAAGTCACTGGG -3'

Sequencing Primer
(F):5'- CATGGTTTCTGCCTAATAAGTCCAG -3'
(R):5'- GATGATGAATCTTGGAAGCATCC -3'
Posted On2016-06-06