Incidental Mutation 'R5083:Comp'
List |< first << previous [record 11 of 55] next >> last >|
ID387259
Institutional Source Beutler Lab
Gene Symbol Comp
Ensembl Gene ENSMUSG00000031849
Gene Namecartilage oligomeric matrix protein
Synonymsthrombospondin-5, TSP5
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location70373558-70382066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70381300 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 655 (T655M)
Ref Sequence ENSEMBL: ENSMUSP00000003659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003659] [ENSMUST00000076615]
PDB Structure
Storage function of COMP:the crystal structure of the coiled-coil domain in complex with vitamin D3 [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
COMPcc in complex with fatty acids [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003659
AA Change: T655M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003659
Gene: ENSMUSG00000031849
AA Change: T655M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:COMP 28 72 6.2e-22 PFAM
EGF 88 124 8.19e-2 SMART
EGF_CA 125 177 5.08e-7 SMART
EGF_CA 178 220 1.73e-9 SMART
EGF 226 265 7.53e-1 SMART
Pfam:TSP_3 299 334 6.1e-16 PFAM
Pfam:TSP_3 358 393 1.2e-15 PFAM
Pfam:TSP_3 393 416 2.7e-6 PFAM
Pfam:TSP_3 417 454 1.6e-14 PFAM
Pfam:TSP_3 455 490 3.7e-14 PFAM
Pfam:TSP_3 491 526 6.1e-15 PFAM
Pfam:TSP_C 544 741 2.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076615
SMART Domains Protein: ENSMUSP00000075916
Gene: ENSMUSG00000003575

DomainStartEndE-ValueType
Pfam:TORC_N 6 66 1.1e-26 PFAM
Pfam:TORC_M 148 289 4.8e-64 PFAM
low complexity region 359 394 N/A INTRINSIC
Pfam:TORC_C 555 630 9.2e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142769
Predicted Effect unknown
Transcript: ENSMUST00000212488
AA Change: T66M
Predicted Effect probably benign
Transcript: ENSMUST00000213072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a noncollagenous extracellular matrix (ECM) protein. It consists of five identical glycoprotein subunits, each with EGF-like and calcium-binding (thrombospondin-like) domains. Oligomerization results from formation of a five-stranded coiled coil and disulfides. Binding to other ECM proteins such as collagen appears to depend on divalent cations. Contraction or expansion of a 5 aa aspartate repeat and other mutations can cause pseudochondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation are indistinguishable from controls. Mice homozygous for a knockin allele with two point mutations exhibit short limb dwarfism, osteoarthritis, abnormal chondrocytes, mild myopathy, and abnormal tendon morphology and stiffness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Comp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01596:Comp APN 8 70378635 missense probably damaging 1.00
IGL02110:Comp APN 8 70373639 missense probably benign 0.08
IGL02721:Comp APN 8 70376081 missense probably damaging 1.00
IGL02812:Comp APN 8 70376687 missense possibly damaging 0.75
IGL03023:Comp APN 8 70378610 unclassified probably benign
IGL03047:Comp UTSW 8 70374909 missense possibly damaging 0.65
R0217:Comp UTSW 8 70378908 missense probably damaging 1.00
R0503:Comp UTSW 8 70375734 missense possibly damaging 0.58
R0659:Comp UTSW 8 70379101 missense possibly damaging 0.84
R1490:Comp UTSW 8 70373913 missense possibly damaging 0.63
R1663:Comp UTSW 8 70373600 missense possibly damaging 0.93
R1666:Comp UTSW 8 70378957 splice site probably null
R1668:Comp UTSW 8 70378957 splice site probably null
R1789:Comp UTSW 8 70377146 missense probably benign 0.01
R2096:Comp UTSW 8 70376063 missense probably damaging 1.00
R2157:Comp UTSW 8 70379570 nonsense probably null
R3836:Comp UTSW 8 70373859 missense probably benign 0.26
R4630:Comp UTSW 8 70374382 missense possibly damaging 0.94
R4743:Comp UTSW 8 70376061 missense probably damaging 1.00
R4747:Comp UTSW 8 70376702 missense probably damaging 1.00
R5028:Comp UTSW 8 70376640 missense probably damaging 0.99
R5070:Comp UTSW 8 70376495 missense probably benign 0.25
R5917:Comp UTSW 8 70376361 splice site probably null
R6705:Comp UTSW 8 70376737 missense probably damaging 0.98
R6965:Comp UTSW 8 70376514 missense probably damaging 1.00
R7309:Comp UTSW 8 70373678 intron probably null
R7402:Comp UTSW 8 70377204 missense probably benign 0.01
R7501:Comp UTSW 8 70379409 missense possibly damaging 0.82
R7541:Comp UTSW 8 70381350 missense probably damaging 1.00
R7568:Comp UTSW 8 70373859 missense probably benign 0.26
R8103:Comp UTSW 8 70381286 missense probably damaging 1.00
Z1177:Comp UTSW 8 70377221 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AATTCACACAGACTCCTGGCTC -3'
(R):5'- ATGTACTGTAAACGGAGCCC -3'

Sequencing Primer
(F):5'- TGGCTCCACTACCCACAGTG -3'
(R):5'- CGTTTCTCCTGGAGCAGCAG -3'
Posted On2016-06-06