Incidental Mutation 'R5083:Fcho1'
ID387261
Institutional Source Beutler Lab
Gene Symbol Fcho1
Ensembl Gene ENSMUSG00000070000
Gene NameFCH domain only 1
Synonyms3322402E17Rik
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.246) question?
Stock #R5083 (G1)
Quality Score213
Status Not validated
Chromosome8
Chromosomal Location71708387-71725716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71717176 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 101 (R101L)
Ref Sequence ENSEMBL: ENSMUSP00000116135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093444] [ENSMUST00000125092] [ENSMUST00000136640] [ENSMUST00000146100] [ENSMUST00000153800]
Predicted Effect probably benign
Transcript: ENSMUST00000093444
AA Change: R101L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091151
Gene: ENSMUSG00000070000
AA Change: R101L

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 4.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123425
SMART Domains Protein: ENSMUSP00000123631
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
low complexity region 52 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125092
SMART Domains Protein: ENSMUSP00000123554
Gene: ENSMUSG00000070000

DomainStartEndE-ValueType
FCH 6 88 7.62e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127005
Predicted Effect probably benign
Transcript: ENSMUST00000136640
AA Change: R101L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000119273
Gene: ENSMUSG00000070000
AA Change: R101L

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143699
Predicted Effect probably benign
Transcript: ENSMUST00000146100
AA Change: R101L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117606
Gene: ENSMUSG00000070000
AA Change: R101L

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
low complexity region 334 351 N/A INTRINSIC
low complexity region 364 382 N/A INTRINSIC
low complexity region 446 466 N/A INTRINSIC
low complexity region 567 576 N/A INTRINSIC
Pfam:muHD 610 872 1.4e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152742
Predicted Effect probably benign
Transcript: ENSMUST00000153800
AA Change: R101L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000116135
Gene: ENSMUSG00000070000
AA Change: R101L

DomainStartEndE-ValueType
FCH 6 92 2.05e-21 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Fcho1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Fcho1 APN 8 71713523 nonsense probably null
IGL01291:Fcho1 APN 8 71712547 missense probably benign 0.08
IGL01473:Fcho1 APN 8 71712138 missense probably benign 0.03
IGL02021:Fcho1 APN 8 71721275 missense probably benign 0.06
IGL02086:Fcho1 APN 8 71716800 missense probably damaging 1.00
IGL02808:Fcho1 APN 8 71712541 missense possibly damaging 0.89
IGL03146:Fcho1 APN 8 71717430 splice site probably benign
IGL03267:Fcho1 APN 8 71712299 unclassified probably benign
ANU05:Fcho1 UTSW 8 71712547 missense probably benign 0.08
R0003:Fcho1 UTSW 8 71708953 missense probably damaging 1.00
R0010:Fcho1 UTSW 8 71709999 missense probably damaging 1.00
R0020:Fcho1 UTSW 8 71716870 missense probably benign 0.11
R0363:Fcho1 UTSW 8 71717490 missense probably damaging 1.00
R0457:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0485:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0501:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0502:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0551:Fcho1 UTSW 8 71712174 missense probably benign 0.06
R0583:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0584:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0585:Fcho1 UTSW 8 71715725 missense probably damaging 1.00
R0612:Fcho1 UTSW 8 71715524 missense probably damaging 1.00
R0614:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0647:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0841:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R0842:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1034:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1036:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1399:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1466:Fcho1 UTSW 8 71712560 missense probably benign 0.00
R1618:Fcho1 UTSW 8 71710403 missense probably damaging 0.98
R1754:Fcho1 UTSW 8 71711246 missense probably benign
R1793:Fcho1 UTSW 8 71709022 nonsense probably null
R2073:Fcho1 UTSW 8 71710489 missense probably damaging 0.98
R2177:Fcho1 UTSW 8 71712261 missense probably damaging 1.00
R4072:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4074:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4076:Fcho1 UTSW 8 71710369 missense probably damaging 0.99
R4606:Fcho1 UTSW 8 71712480 missense probably benign
R4732:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4733:Fcho1 UTSW 8 71716795 missense probably benign 0.00
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R4860:Fcho1 UTSW 8 71710481 missense probably benign 0.04
R5082:Fcho1 UTSW 8 71717185 missense possibly damaging 0.69
R5185:Fcho1 UTSW 8 71714956 unclassified probably benign
R6025:Fcho1 UTSW 8 71712573 splice site probably null
R6624:Fcho1 UTSW 8 71709371 missense probably damaging 0.99
R6875:Fcho1 UTSW 8 71714425 intron probably null
R7069:Fcho1 UTSW 8 71710497 splice site probably null
R7476:Fcho1 UTSW 8 71713546 missense probably damaging 1.00
R7512:Fcho1 UTSW 8 71716863 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTTACACTGTGGTGGGATG -3'
(R):5'- ATATCAGCAATGACGGCAGTG -3'

Sequencing Primer
(F):5'- GGTGGAACCCTGCCTAGG -3'
(R):5'- AGCAATGACGGCAGTGTTGTG -3'
Posted On2016-06-06