Incidental Mutation 'R5083:Olfr250'
ID387264
Institutional Source Beutler Lab
Gene Symbol Olfr250
Ensembl Gene ENSMUSG00000049864
Gene Nameolfactory receptor 250
SynonymsGA_x6K02T2MYUG-19447-18473, MOR170-14
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38366896-38371355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38368062 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 172 (C172Y)
Ref Sequence ENSEMBL: ENSMUSP00000051631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052085] [ENSMUST00000216168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052085
AA Change: C172Y

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051631
Gene: ENSMUSG00000049864
AA Change: C172Y

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 1.2e-46 PFAM
Pfam:7tm_1 51 300 3.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216168
AA Change: C162Y

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Olfr250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Olfr250 APN 9 38368050 missense probably benign 0.01
IGL02073:Olfr250 APN 9 38368307 missense probably damaging 1.00
IGL02499:Olfr250 APN 9 38367681 missense probably benign 0.12
IGL03011:Olfr250 APN 9 38368068 missense possibly damaging 0.89
R0313:Olfr250 UTSW 9 38368304 missense probably damaging 1.00
R1457:Olfr250 UTSW 9 38368196 missense probably benign 0.01
R1546:Olfr250 UTSW 9 38367548 start codon destroyed probably benign
R1665:Olfr250 UTSW 9 38367566 missense probably benign
R1718:Olfr250 UTSW 9 38367594 missense probably benign 0.00
R1861:Olfr250 UTSW 9 38367606 missense probably benign 0.08
R1900:Olfr250 UTSW 9 38368064 missense probably benign 0.05
R2363:Olfr250 UTSW 9 38368098 missense probably damaging 1.00
R4270:Olfr250 UTSW 9 38367701 missense probably damaging 1.00
R5058:Olfr250 UTSW 9 38367924 missense probably damaging 1.00
R5422:Olfr250 UTSW 9 38367974 missense probably benign 0.05
R5630:Olfr250 UTSW 9 38368106 missense probably damaging 1.00
R6559:Olfr250 UTSW 9 38367756 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGATGCATGACTCAGC -3'
(R):5'- GCTTTGGACCAACCCTTAGATG -3'

Sequencing Primer
(F):5'- ACAGCCATGGCCTATGAT -3'
(R):5'- CTTTGGACCAACCCTTAGATGATGAC -3'
Posted On2016-06-06