Incidental Mutation 'R5083:Myo19'
ID387269
Institutional Source Beutler Lab
Gene Symbol Myo19
Ensembl Gene ENSMUSG00000020527
Gene Namemyosin XIX
SynonymsMyohd1, 1110055A02Rik
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84880148-84911226 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 84903211 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 654 (A654S)
Ref Sequence ENSEMBL: ENSMUSP00000091502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093969]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093969
AA Change: A654S

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091502
Gene: ENSMUSG00000020527
AA Change: A654S

DomainStartEndE-ValueType
MYSc 29 759 4.07e-219 SMART
IQ 760 782 1.74e1 SMART
IQ 783 804 1.97e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141705
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Myo19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Myo19 APN 11 84909498 missense probably benign 0.00
IGL01120:Myo19 APN 11 84907278 missense probably damaging 0.96
IGL01542:Myo19 APN 11 84909546 missense probably damaging 0.96
IGL02341:Myo19 APN 11 84888045 splice site probably benign
IGL02708:Myo19 APN 11 84899396 missense possibly damaging 0.89
IGL03223:Myo19 APN 11 84910471 missense possibly damaging 0.57
R0009:Myo19 UTSW 11 84888169 critical splice donor site probably null
R0125:Myo19 UTSW 11 84888175 splice site probably benign
R0142:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R0226:Myo19 UTSW 11 84897732 splice site probably benign
R0230:Myo19 UTSW 11 84893333 missense possibly damaging 0.91
R0482:Myo19 UTSW 11 84909419 missense probably benign 0.00
R1981:Myo19 UTSW 11 84892170 missense possibly damaging 0.46
R2035:Myo19 UTSW 11 84897608 missense probably benign
R2185:Myo19 UTSW 11 84892221 missense probably benign 0.00
R3176:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3276:Myo19 UTSW 11 84892175 missense probably benign 0.01
R3824:Myo19 UTSW 11 84885679 missense probably damaging 0.98
R3914:Myo19 UTSW 11 84894603 missense probably damaging 1.00
R4333:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4335:Myo19 UTSW 11 84908288 missense probably benign 0.00
R4647:Myo19 UTSW 11 84894642 missense probably damaging 1.00
R4968:Myo19 UTSW 11 84901502 missense probably damaging 1.00
R4971:Myo19 UTSW 11 84892197 missense probably damaging 1.00
R5284:Myo19 UTSW 11 84885272 unclassified probably null
R5558:Myo19 UTSW 11 84910448 missense probably damaging 1.00
R5739:Myo19 UTSW 11 84897624 missense probably damaging 1.00
R5982:Myo19 UTSW 11 84899400 missense probably damaging 0.97
R6093:Myo19 UTSW 11 84885709 missense probably damaging 1.00
R6444:Myo19 UTSW 11 84895308 missense probably benign
R6657:Myo19 UTSW 11 84897196 missense probably benign
R6945:Myo19 UTSW 11 84897560 missense probably benign 0.06
R7022:Myo19 UTSW 11 84900547 missense probably damaging 0.99
R7058:Myo19 UTSW 11 84907368 missense possibly damaging 0.89
R7150:Myo19 UTSW 11 84905613 missense probably benign
R7155:Myo19 UTSW 11 84900586 missense probably damaging 1.00
R7478:Myo19 UTSW 11 84885800 missense probably benign 0.41
R7486:Myo19 UTSW 11 84905637 missense probably benign
R7833:Myo19 UTSW 11 84909267 missense probably benign
R7916:Myo19 UTSW 11 84909267 missense probably benign
X0053:Myo19 UTSW 11 84897715 nonsense probably null
Z1176:Myo19 UTSW 11 84885278 missense probably benign 0.05
Z1176:Myo19 UTSW 11 84909350 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTTAGCTATATGAGGAGCCAGG -3'
(R):5'- TAGGAATGTAGGCCCTACCAGG -3'

Sequencing Primer
(F):5'- GGTTTCTCATGATCCCACAGAGAC -3'
(R):5'- CAGGGCAGAGATTCCACACTG -3'
Posted On2016-06-06