Incidental Mutation 'R5083:Abca6'
ID387272
Institutional Source Beutler Lab
Gene Symbol Abca6
Ensembl Gene ENSMUSG00000044749
Gene NameATP-binding cassette, sub-family A (ABC1), member 6
Synonyms6330565N06Rik
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location110176820-110251776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110218967 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 646 (D646G)
Ref Sequence ENSEMBL: ENSMUSP00000035458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044003]
Predicted Effect probably damaging
Transcript: ENSMUST00000044003
AA Change: D646G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: D646G

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 416 1.4e-42 PFAM
low complexity region 484 495 N/A INTRINSIC
AAA 506 691 1.13e-6 SMART
transmembrane domain 854 876 N/A INTRINSIC
transmembrane domain 971 990 N/A INTRINSIC
transmembrane domain 1005 1027 N/A INTRINSIC
Blast:AAA 1041 1176 4e-21 BLAST
transmembrane domain 1191 1213 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
AAA 1312 1505 2.43e-6 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Abca6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca6 APN 11 110184709 missense probably damaging 1.00
IGL00569:Abca6 APN 11 110187049 missense possibly damaging 0.88
IGL00737:Abca6 APN 11 110196997 splice site probably benign
IGL01024:Abca6 APN 11 110197142 missense probably benign
IGL01087:Abca6 APN 11 110191650 missense probably benign 0.00
IGL01511:Abca6 APN 11 110244310 missense probably benign 0.00
IGL01516:Abca6 APN 11 110218217 missense possibly damaging 0.70
IGL01621:Abca6 APN 11 110184708 missense probably damaging 1.00
IGL01749:Abca6 APN 11 110244224 missense probably damaging 1.00
IGL01934:Abca6 APN 11 110188655 missense probably benign 0.00
IGL02010:Abca6 APN 11 110219616 missense probably benign 0.12
IGL02121:Abca6 APN 11 110182924 missense probably benign 0.38
IGL02423:Abca6 APN 11 110219006 splice site probably benign
IGL02428:Abca6 APN 11 110178792 missense possibly damaging 0.81
IGL02491:Abca6 APN 11 110176968 utr 3 prime probably benign
IGL02541:Abca6 APN 11 110212267 missense probably damaging 1.00
IGL02792:Abca6 APN 11 110188681 missense probably damaging 0.99
IGL02836:Abca6 APN 11 110248548 missense probably damaging 1.00
IGL02965:Abca6 APN 11 110180613 missense probably benign
IGL03094:Abca6 APN 11 110184112 missense probably benign 0.03
IGL03109:Abca6 APN 11 110180347 missense probably damaging 0.96
R0068:Abca6 UTSW 11 110182882 missense probably damaging 1.00
R0142:Abca6 UTSW 11 110188641 missense probably damaging 1.00
R0165:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R0254:Abca6 UTSW 11 110236789 missense probably benign 0.16
R0598:Abca6 UTSW 11 110197154 missense probably damaging 1.00
R0992:Abca6 UTSW 11 110211684 missense probably damaging 1.00
R1386:Abca6 UTSW 11 110244255 missense probably benign 0.02
R1642:Abca6 UTSW 11 110218281 missense possibly damaging 0.73
R1673:Abca6 UTSW 11 110212339 missense probably benign 0.01
R1792:Abca6 UTSW 11 110184044 missense probably benign 0.00
R1813:Abca6 UTSW 11 110233845 splice site probably benign
R1817:Abca6 UTSW 11 110219318 missense probably benign 0.00
R1842:Abca6 UTSW 11 110197039 missense probably benign 0.00
R1898:Abca6 UTSW 11 110208799 missense probably damaging 0.99
R1914:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1915:Abca6 UTSW 11 110212210 missense probably benign 0.06
R1934:Abca6 UTSW 11 110210083 critical splice donor site probably null
R1964:Abca6 UTSW 11 110184676 missense probably damaging 0.98
R1967:Abca6 UTSW 11 110187148 missense probably benign 0.09
R2127:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2128:Abca6 UTSW 11 110219649 missense probably benign 0.00
R2164:Abca6 UTSW 11 110210193 frame shift probably null
R2895:Abca6 UTSW 11 110202426 missense probably benign 0.00
R3110:Abca6 UTSW 11 110178829 nonsense probably null
R3111:Abca6 UTSW 11 110178829 nonsense probably null
R3112:Abca6 UTSW 11 110178829 nonsense probably null
R4094:Abca6 UTSW 11 110180366 missense probably damaging 1.00
R4432:Abca6 UTSW 11 110241588 missense probably benign 0.11
R4474:Abca6 UTSW 11 110233772 missense possibly damaging 0.46
R4572:Abca6 UTSW 11 110216548 missense probably benign 0.31
R4629:Abca6 UTSW 11 110230549 critical splice acceptor site probably null
R4793:Abca6 UTSW 11 110191718 missense probably benign
R4852:Abca6 UTSW 11 110244203 missense probably benign 0.09
R4867:Abca6 UTSW 11 110202379 missense probably benign 0.01
R4879:Abca6 UTSW 11 110219700 missense probably damaging 0.98
R4918:Abca6 UTSW 11 110180551 missense probably damaging 1.00
R5060:Abca6 UTSW 11 110219604 missense possibly damaging 0.90
R5062:Abca6 UTSW 11 110177066 missense probably benign 0.12
R5173:Abca6 UTSW 11 110191720 missense probably benign
R5393:Abca6 UTSW 11 110244295 missense probably benign 0.00
R5484:Abca6 UTSW 11 110184073 missense probably damaging 1.00
R5498:Abca6 UTSW 11 110208844 missense possibly damaging 0.95
R5503:Abca6 UTSW 11 110218257 missense probably damaging 1.00
R5645:Abca6 UTSW 11 110250408 missense probably damaging 0.99
R5680:Abca6 UTSW 11 110236645 missense possibly damaging 0.88
R5761:Abca6 UTSW 11 110210101 missense probably damaging 1.00
R5779:Abca6 UTSW 11 110184670 missense probably benign 0.37
R5818:Abca6 UTSW 11 110219643 missense probably damaging 1.00
R6282:Abca6 UTSW 11 110208824 missense probably damaging 0.98
R6455:Abca6 UTSW 11 110241581 missense probably damaging 1.00
R6826:Abca6 UTSW 11 110216605 missense probably benign 0.15
R6857:Abca6 UTSW 11 110219688 missense possibly damaging 0.63
R6914:Abca6 UTSW 11 110190238 missense probably benign
R6931:Abca6 UTSW 11 110244328 missense probably benign 0.27
R7222:Abca6 UTSW 11 110191693 missense probably benign 0.29
R7242:Abca6 UTSW 11 110241653 missense possibly damaging 0.47
R7297:Abca6 UTSW 11 110183026 critical splice donor site probably null
R7387:Abca6 UTSW 11 110202420 missense probably benign
R7420:Abca6 UTSW 11 110250477 missense probably benign 0.24
R7494:Abca6 UTSW 11 110208745 missense possibly damaging 0.93
R7603:Abca6 UTSW 11 110180258 missense possibly damaging 0.69
R7637:Abca6 UTSW 11 110218952 missense probably benign 0.00
R7674:Abca6 UTSW 11 110219297 missense probably damaging 1.00
R7753:Abca6 UTSW 11 110184107 missense probably damaging 1.00
R7800:Abca6 UTSW 11 110187872 missense probably benign 0.00
R7842:Abca6 UTSW 11 110196697 missense possibly damaging 0.76
R7855:Abca6 UTSW 11 110191628 missense probably benign 0.01
R8119:Abca6 UTSW 11 110197104 missense probably benign 0.00
R8139:Abca6 UTSW 11 110184133 missense probably damaging 1.00
R8176:Abca6 UTSW 11 110244194 missense probably benign 0.01
R8179:Abca6 UTSW 11 110245274 missense probably damaging 1.00
R8197:Abca6 UTSW 11 110211815 missense probably damaging 0.99
R8241:Abca6 UTSW 11 110188630 missense probably null 1.00
R8404:Abca6 UTSW 11 110219319 missense probably damaging 0.99
R8429:Abca6 UTSW 11 110202382 missense probably benign
R8502:Abca6 UTSW 11 110219319 missense probably damaging 0.99
X0024:Abca6 UTSW 11 110244255 missense probably benign 0.02
X0064:Abca6 UTSW 11 110197142 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACCAGGGCTCTTAACCCTAG -3'
(R):5'- CTCAGTAAGAGTCATGCAGGG -3'

Sequencing Primer
(F):5'- GGCTCTTAACCCTAGGAATAAAGGTC -3'
(R):5'- AAGAGTCATGCAGGGCTTTTAGC -3'
Posted On2016-06-06