Mutagenetix > Incidental Mutation

Incidental Mutation 'R5083:Gphn'

387274

Institutional Source

Beutler Lab

Gene Symbol

Gphn

Ensembl Gene

ENSMUSG00000047454

Gene Name

gephyrin

Synonyms

5730552E08Rik, geph

MMRRC Submission

042672-MU

Accession Numbers

Genbank: NM_145965, NM_172952; MGI: 109602

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5083 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78226379-78684772 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 78623289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000106018 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052472] [ENSMUST00000052472] [ENSMUST00000110388] [ENSMUST00000110388]

AlphaFold

Q8BUV3

Predicted Effect

probably null
Transcript: ENSMUST00000052472

SMART Domains

Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	356	522	5.6e-53	PFAM
MoCF_biosynth	535	678	8.1e-38	SMART
Pfam:MoeA_C	691	766	8.9e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000052472

SMART Domains

Protein: ENSMUSP00000054064
Gene: ENSMUSG00000047454

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	356	522	5.6e-53	PFAM
MoCF_biosynth	535	678	8.1e-38	SMART
Pfam:MoeA_C	691	766	8.9e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110388

SMART Domains

Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	360	525	2.1e-35	PFAM
MoCF_biosynth	538	681	8.1e-38	SMART
Pfam:MoeA_C	694	769	8.1e-26	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110388

SMART Domains

Protein: ENSMUSP00000106018
Gene: ENSMUSG00000047454

Domain	Start	End	E-Value	Type
MoCF_biosynth	18	165	4.52e-27	SMART
low complexity region	186	201	N/A	INTRINSIC
Pfam:MoeA_N	360	525	2.1e-35	PFAM
MoCF_biosynth	538	681	8.1e-38	SMART
Pfam:MoeA_C	694	769	8.1e-26	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a neuronal assembly protein that anchors inhibitory neurotransmitter receptors to the postsynaptic cytoskeleton via high affinity binding to a receptor subunit domain and tubulin dimers. In nonneuronal tissues, the encoded protein is also required for molybdenum cofactor biosynthesis. Mutations in this gene may be associated with the neurological condition hyperplexia and also lead to molybdenum cofactor deficiency. Numerous alternatively spliced transcript variants encoding different isoforms have been described; however, the full-length nature of all transcript variants is not currently known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene die within one day of birth, apparently due to an inability to suckle. Apnea also develops within 12 hours of birth. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Targeted, knock-out(1) Gene trapped(10)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530064D06Rik	C	T	17: 48,166,390	V120M	possibly damaging	Het
Abca6	T	C	11: 110,218,967	D646G	probably damaging	Het
Agbl5	G	A	5: 30,903,059	R141Q	probably damaging	Het
Arid1b	A	G	17: 5,314,018	T554A	possibly damaging	Het
Atp2a3	G	T	11: 72,982,826	V824L	probably null	Het
Bet1	T	C	6: 4,077,895	I115V	possibly damaging	Het
Cdc23	C	A	18: 34,651,689	V7L	unknown	Het
Cfap65	A	G	1: 74,906,441	S1373P	probably damaging	Het
Chd9	T	C	8: 90,984,374	L353P	probably damaging	Het
Chil3	C	A	3: 106,164,089		probably null	Het
Comp	C	T	8: 70,381,300	T655M	probably damaging	Het
Dctd	T	C	8: 48,111,716	Y18H	probably damaging	Het
Ddx39b	G	A	17: 35,253,029	G348D	possibly damaging	Het
Dhx36	A	T	3: 62,471,999	S889R	probably benign	Het
Dtx2	T	C	5: 136,012,190	Y150H	probably damaging	Het
Epx	A	G	11: 87,872,680	F238S	probably damaging	Het
Ergic2	T	C	6: 148,196,014	T154A	probably benign	Het
Esco1	A	G	18: 10,594,734	I184T	probably benign	Het
Esf1	G	T	2: 140,157,071	A495E	possibly damaging	Het
Esf1	T	C	2: 140,158,579	Y429C	possibly damaging	Het
Fcho1	C	A	8: 71,717,176	R101L	probably benign	Het
Foxn4	T	A	5: 114,256,927	D313V	probably damaging	Het
Gm11568	T	C	11: 99,857,972	M1T	probably null	Het
Gm14409	A	G	2: 177,265,571	F45L	probably damaging	Het
Grid2	C	T	6: 64,320,152	Q500*	probably null	Het
Igsf10	A	G	3: 59,326,273	S1680P	probably damaging	Het
Ints12	T	C	3: 133,100,777	M155T	possibly damaging	Het
Invs	A	T	4: 48,396,307	M327L	possibly damaging	Het
Kdm3a	T	C	6: 71,621,362	E180G	probably damaging	Het
Mgat3	G	A	15: 80,211,298	V109M	possibly damaging	Het
Mrgprb3	A	G	7: 48,643,014	V263A	probably benign	Het
Mroh7	A	T	4: 106,690,318	V1109D	probably benign	Het
Myo15b	A	T	11: 115,866,656	T1111S	probably benign	Het
Myo19	G	T	11: 84,903,211	A654S	possibly damaging	Het
Mypn	A	T	10: 63,118,528	V1224D	probably damaging	Het
Nalcn	A	G	14: 123,323,294		probably null	Het
Olfr250	G	A	9: 38,368,062	C172Y	possibly damaging	Het
Olfr437	G	T	6: 43,167,339	A94S	probably benign	Het
Olfr676	A	T	7: 105,035,411	Y71F	probably damaging	Het
Pdcd2	A	G	17: 15,522,822	I247T	possibly damaging	Het
Pik3c2a	A	T	7: 116,342,401	N1571K	probably damaging	Het
Plagl2	T	C	2: 153,236,044	T6A	probably benign	Het
Ros1	T	A	10: 52,163,941	Y318F	possibly damaging	Het
Sdccag8	C	A	1: 176,824,892	H70N	probably damaging	Het
Skint1	A	G	4: 112,029,433	R359G	probably benign	Het
Slc44a5	A	T	3: 154,247,787	I269L	probably benign	Het
Slfn10-ps	T	A	11: 83,030,515		noncoding transcript	Het
Suclg1	C	A	6: 73,263,980	T164K	probably benign	Het
Tgds	C	A	14: 118,116,079		probably null	Het
Ttn	T	C	2: 76,813,533	D13117G	probably damaging	Het
Ttn	T	C	2: 76,870,737		probably benign	Het
Vmn2r28	A	T	7: 5,480,672	I843N	possibly damaging	Het
Vmn2r52	A	T	7: 10,159,465	Y582*	probably null	Het
Vps33b	G	T	7: 80,274,641	K65N	probably damaging	Het

Other mutations in Gphn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Gphn	APN	12	78504632	missense	probably damaging	1.00
IGL00701:Gphn	APN	12	78626167	missense	possibly damaging	0.93
IGL00844:Gphn	APN	12	78664568	splice site	probably benign
IGL01517:Gphn	APN	12	78376374	missense	probably damaging	1.00
IGL02499:Gphn	APN	12	78492300	missense	probably benign	0.17
IGL02827:Gphn	APN	12	78609220	missense	probably damaging	1.00
IGL03136:Gphn	APN	12	78481333	missense	possibly damaging	0.69
IGL03348:Gphn	APN	12	78627119	missense	probably damaging	0.99
IGL03382:Gphn	APN	12	78481313	missense	probably damaging	1.00
grizzlies	UTSW	12	78654880	missense	probably benign	0.28
3-1:Gphn	UTSW	12	78613001	missense	probably benign	0.06
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0054:Gphn	UTSW	12	78637503	missense	probably damaging	1.00
R0212:Gphn	UTSW	12	78637552	missense	probably damaging	0.99
R0389:Gphn	UTSW	12	78590659	missense	probably damaging	1.00
R0535:Gphn	UTSW	12	78492050	missense	possibly damaging	0.90
R1464:Gphn	UTSW	12	78612964	splice site	probably benign
R1503:Gphn	UTSW	12	78504629	missense	possibly damaging	0.94
R1606:Gphn	UTSW	12	78683883	missense	probably damaging	1.00
R1896:Gphn	UTSW	12	78412354	missense	possibly damaging	0.74
R2248:Gphn	UTSW	12	78454821	missense	probably damaging	1.00
R3708:Gphn	UTSW	12	78532693	missense	probably benign
R3907:Gphn	UTSW	12	78493942	splice site	probably benign
R4537:Gphn	UTSW	12	78494014	missense	probably benign	0.03
R4667:Gphn	UTSW	12	78454817	missense	probably damaging	1.00
R4808:Gphn	UTSW	12	78654880	missense	probably benign	0.28
R4840:Gphn	UTSW	12	78522955	critical splice donor site	probably null
R4852:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R4854:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R4855:Gphn	UTSW	12	78627210	missense	probably damaging	1.00
R5224:Gphn	UTSW	12	78590587	missense	probably damaging	0.99
R5580:Gphn	UTSW	12	78492044	missense	probably damaging	1.00
R5626:Gphn	UTSW	12	78683897	missense	probably benign	0.11
R6270:Gphn	UTSW	12	78522950	missense	probably benign
R6563:Gphn	UTSW	12	78680396	critical splice donor site	probably null
R6943:Gphn	UTSW	12	78492181	missense	possibly damaging	0.88
R6958:Gphn	UTSW	12	78680299	missense	possibly damaging	0.86
R7170:Gphn	UTSW	12	78683889	missense	possibly damaging	0.67
R7295:Gphn	UTSW	12	78492102	missense	probably benign	0.02
R7514:Gphn	UTSW	12	78626165	missense	probably damaging	0.97
R7537:Gphn	UTSW	12	78504680	missense	possibly damaging	0.62
R7680:Gphn	UTSW	12	78412374	missense	probably benign	0.14
R8236:Gphn	UTSW	12	78664537	missense	probably damaging	1.00
R8377:Gphn	UTSW	12	78664506	missense	probably damaging	1.00
R8409:Gphn	UTSW	12	78613010	missense	probably damaging	1.00
R8468:Gphn	UTSW	12	78226827	missense	probably benign	0.22
R8742:Gphn	UTSW	12	78612992	missense	probably damaging	1.00
R8832:Gphn	UTSW	12	78412400	synonymous	silent
R8845:Gphn	UTSW	12	78492179	missense	probably benign	0.30
R8972:Gphn	UTSW	12	78609239	critical splice donor site	probably null
R9254:Gphn	UTSW	12	78627262	critical splice donor site	probably null
R9287:Gphn	UTSW	12	78562872	missense	possibly damaging	0.68
R9355:Gphn	UTSW	12	78492194	missense	probably damaging	0.97
R9536:Gphn	UTSW	12	78562862	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TGGTCGTGCAAACTTTATAAGTCTCAG -3'
(R):5'- TATGACTTCTAATACTGCCACAGGAAC -3'

Sequencing Primer
(F):5'- TCTCAGTACAGGAGATAGCTAGGGC -3'
(R):5'- ACCTGGTGGTGACATACATCATCTG -3'

Posted On

2016-06-06