Incidental Mutation 'R5083:Pdcd2'
List |< first << previous [record 41 of 55] next >> last >|
ID387279
Institutional Source Beutler Lab
Gene Symbol Pdcd2
Ensembl Gene ENSMUSG00000014771
Gene Nameprogrammed cell death 2
SynonymsRP-8
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location15519208-15527301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15522822 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 247 (I247T)
Ref Sequence ENSEMBL: ENSMUSP00000052523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054450] [ENSMUST00000154293] [ENSMUST00000162505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000054450
AA Change: I247T

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052523
Gene: ENSMUSG00000014771
AA Change: I247T

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Pfam:zf-MYND 134 171 2.2e-10 PFAM
Pfam:PDCD2_C 188 338 6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125709
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139610
Predicted Effect probably benign
Transcript: ENSMUST00000154293
AA Change: I247T

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118625
Gene: ENSMUSG00000014771
AA Change: I247T

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
Pfam:zf-MYND 134 171 4.3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162505
SMART Domains Protein: ENSMUSP00000124317
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Pfam:TBP 139 221 1.1e-34 PFAM
Pfam:TBP 229 312 8.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232149
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein expressed in a variety of tissues. Expression of this gene has been shown to be repressed by B-cell CLL/lymphoma 6 (BCL6), a transcriptional repressor required for lymph node germinal center development, suggesting that BCL6 regulates apoptosis by its effects on this protein. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 9 and 12. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality before implantation with most arresting before the blastocyst satge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Ddx39b G A 17: 35,253,029 G348D possibly damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Pdcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02632:Pdcd2 APN 17 15521792 missense probably damaging 0.99
R0433:Pdcd2 UTSW 17 15526384 missense probably benign 0.37
R1368:Pdcd2 UTSW 17 15526584 missense probably damaging 1.00
R5508:Pdcd2 UTSW 17 15521739 missense probably damaging 1.00
R5963:Pdcd2 UTSW 17 15526394 missense possibly damaging 0.91
R5963:Pdcd2 UTSW 17 15526395 missense probably damaging 1.00
R6944:Pdcd2 UTSW 17 15525370 missense possibly damaging 0.82
R6993:Pdcd2 UTSW 17 15527081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACACTTAGTTGAGCCCGTG -3'
(R):5'- CACTAATGTTACTTGACTAGAGGAAGC -3'

Sequencing Primer
(F):5'- ACACTTAGTTGAGCCCGTGTTTTTG -3'
(R):5'- TTCAGGGGGAATTCCTGA -3'
Posted On2016-06-06