Incidental Mutation 'R5083:Ddx39b'
ID387281
Institutional Source Beutler Lab
Gene Symbol Ddx39b
Ensembl Gene ENSMUSG00000019432
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 39B
SynonymsD17H6S81E-1, Bat1, Bat1a, Bat-1, 0610030D10Rik
MMRRC Submission 042672-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R5083 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35241746-35253707 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35253029 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 348 (G348D)
Ref Sequence ENSEMBL: ENSMUSP00000133428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068056] [ENSMUST00000172549] [ENSMUST00000173731] [ENSMUST00000174757]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068056
AA Change: G348D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000070682
Gene: ENSMUSG00000019432
AA Change: G348D

DomainStartEndE-ValueType
DEXDc 64 265 7.17e-55 SMART
HELICc 301 382 1.48e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172549
AA Change: G348D

PolyPhen 2 Score 0.233 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134178
Gene: ENSMUSG00000019432
AA Change: G348D

DomainStartEndE-ValueType
DEXDc 64 265 7.17e-55 SMART
HELICc 301 382 1.48e-24 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173731
AA Change: G348D

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133428
Gene: ENSMUSG00000019432
AA Change: G348D

DomainStartEndE-ValueType
DEXDc 64 265 7.17e-55 SMART
HELICc 301 382 1.48e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174164
Predicted Effect probably benign
Transcript: ENSMUST00000174757
SMART Domains Protein: ENSMUSP00000133705
Gene: ENSMUSG00000019432

DomainStartEndE-ValueType
DEXDc 1 147 2.85e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183361
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box family of RNA-dependent ATPases that mediate ATP hydrolysis during pre-mRNA splicing. The encoded protein is an essential splicing factor required for association of U2 small nuclear ribonucleoprotein with pre-mRNA, and it also plays an important role in mRNA export from the nucleus to the cytoplasm. This gene belongs to a cluster of genes localized in the vicinity of the genes encoding tumor necrosis factor alpha and tumor necrosis factor beta. These genes are all within the human major histocompatibility complex class III region. Mutations in this gene may be associated with rheumatoid arthritis. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on both chromosomes 6 and 11. Read-through transcription also occurs between this gene and the upstream ATP6V1G2 (ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G2) gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik C T 17: 48,166,390 V120M possibly damaging Het
Abca6 T C 11: 110,218,967 D646G probably damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arid1b A G 17: 5,314,018 T554A possibly damaging Het
Atp2a3 G T 11: 72,982,826 V824L probably null Het
Bet1 T C 6: 4,077,895 I115V possibly damaging Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cfap65 A G 1: 74,906,441 S1373P probably damaging Het
Chd9 T C 8: 90,984,374 L353P probably damaging Het
Chil3 C A 3: 106,164,089 probably null Het
Comp C T 8: 70,381,300 T655M probably damaging Het
Dctd T C 8: 48,111,716 Y18H probably damaging Het
Dhx36 A T 3: 62,471,999 S889R probably benign Het
Dtx2 T C 5: 136,012,190 Y150H probably damaging Het
Epx A G 11: 87,872,680 F238S probably damaging Het
Ergic2 T C 6: 148,196,014 T154A probably benign Het
Esco1 A G 18: 10,594,734 I184T probably benign Het
Esf1 G T 2: 140,157,071 A495E possibly damaging Het
Esf1 T C 2: 140,158,579 Y429C possibly damaging Het
Fcho1 C A 8: 71,717,176 R101L probably benign Het
Foxn4 T A 5: 114,256,927 D313V probably damaging Het
Gm11568 T C 11: 99,857,972 M1T probably null Het
Gm14409 A G 2: 177,265,571 F45L probably damaging Het
Gphn T A 12: 78,623,289 probably null Het
Grid2 C T 6: 64,320,152 Q500* probably null Het
Igsf10 A G 3: 59,326,273 S1680P probably damaging Het
Ints12 T C 3: 133,100,777 M155T possibly damaging Het
Invs A T 4: 48,396,307 M327L possibly damaging Het
Kdm3a T C 6: 71,621,362 E180G probably damaging Het
Mgat3 G A 15: 80,211,298 V109M possibly damaging Het
Mrgprb3 A G 7: 48,643,014 V263A probably benign Het
Mroh7 A T 4: 106,690,318 V1109D probably benign Het
Myo15b A T 11: 115,866,656 T1111S probably benign Het
Myo19 G T 11: 84,903,211 A654S possibly damaging Het
Mypn A T 10: 63,118,528 V1224D probably damaging Het
Nalcn A G 14: 123,323,294 probably null Het
Olfr250 G A 9: 38,368,062 C172Y possibly damaging Het
Olfr437 G T 6: 43,167,339 A94S probably benign Het
Olfr676 A T 7: 105,035,411 Y71F probably damaging Het
Pdcd2 A G 17: 15,522,822 I247T possibly damaging Het
Pik3c2a A T 7: 116,342,401 N1571K probably damaging Het
Plagl2 T C 2: 153,236,044 T6A probably benign Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Sdccag8 C A 1: 176,824,892 H70N probably damaging Het
Skint1 A G 4: 112,029,433 R359G probably benign Het
Slc44a5 A T 3: 154,247,787 I269L probably benign Het
Slfn10-ps T A 11: 83,030,515 noncoding transcript Het
Suclg1 C A 6: 73,263,980 T164K probably benign Het
Tgds C A 14: 118,116,079 probably null Het
Ttn T C 2: 76,813,533 D13117G probably damaging Het
Ttn T C 2: 76,870,737 probably benign Het
Vmn2r28 A T 7: 5,480,672 I843N possibly damaging Het
Vmn2r52 A T 7: 10,159,465 Y582* probably null Het
Vps33b G T 7: 80,274,641 K65N probably damaging Het
Other mutations in Ddx39b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Ddx39b APN 17 35246961 missense probably benign
IGL02932:Ddx39b APN 17 35253361 unclassified probably benign
R4111:Ddx39b UTSW 17 35243364 missense possibly damaging 0.93
R4133:Ddx39b UTSW 17 35253089 missense probably damaging 1.00
R4654:Ddx39b UTSW 17 35253488 makesense probably null
R5698:Ddx39b UTSW 17 35251311 missense probably benign 0.16
R7060:Ddx39b UTSW 17 35252750 missense probably damaging 0.96
R7073:Ddx39b UTSW 17 35252850 missense probably benign 0.00
R7087:Ddx39b UTSW 17 35253049 missense probably damaging 1.00
R7159:Ddx39b UTSW 17 35247010 missense probably benign 0.07
R7251:Ddx39b UTSW 17 35253488 makesense probably null
R7554:Ddx39b UTSW 17 35247030 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAGTGGAACAGAACTTCCCAG -3'
(R):5'- GAAGGGTTAGACTGCAAGCCTC -3'

Sequencing Primer
(F):5'- GCCATTGCTATCCATCGTGGAATG -3'
(R):5'- TTAGACTGCAAGCCTCCCAGG -3'
Posted On2016-06-06